View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8909_low_41 (Length: 271)
Name: NF8909_low_41
Description: NF8909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8909_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 19 - 253
Target Start/End: Original strand, 5676726 - 5676960
Alignment:
| Q |
19 |
aacgtgtccccggtaaatgaatatgaaggaatgagaagatcatccaaaacagcttgtcctaattgcattgccattcttttctccaaatcaagcctgcaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5676726 |
aacgtgtccccggtaaatgaatatgaaggaatgagaagatcatccagaacagcttgtcctaattgcattgccattcttttctccaaatcaagcctgcaag |
5676825 |
T |
|
| Q |
119 |
caactgttgtatcaagatatatcgctgcacgtagcagcatagatagaaagcttactgacattgcattcttctcttttggtaataggctcactattgtctc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5676826 |
caactgttgtatcaagatatatcgctgcacgtagcagcatagatagaaagcttactgacattgcattcttctcttttggtaataggctcactattgtctc |
5676925 |
T |
|
| Q |
219 |
taaaataaccctcttttcatgctcttgtcttggtt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
5676926 |
taaaataaccctcttttcatgctcttgtcttggtt |
5676960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 41 - 244
Target Start/End: Complemental strand, 39779078 - 39778875
Alignment:
| Q |
41 |
atgaaggaatgagaagatcatccaaaacagcttgtcctaattgcattgccattcttttctccaaatcaagcctgcaagcaactgttgtatcaagatatat |
140 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||| || || ||| |||||||||||| |||||||||||| ||||| ||||||||||| |
|
|
| T |
39779078 |
atgaaggaaaaagaagatcatccaaaacagcctgtcctaattgcatggctatccttctctccaaatcaaacctgcaagcaacagttgtctcaagatatat |
39778979 |
T |
|
| Q |
141 |
cgctgcacgtagcagcatagatagaaagcttactgacattgcattcttctcttttggtaataggctcactattgtctctaaaataaccctcttttcatgc |
240 |
Q |
| |
|
||||| ||| | || |||||||| || || |||||||||||||| |||| | |||||||||| | |||||||||||| ||||| |||||| |
|
|
| T |
39778978 |
tgctgccttaagccatagtgaaagaaagctgacagatattgcattcttctcccttggcataaggctcactagtatctctaaaataagtctcttctcatgc |
39778879 |
T |
|
| Q |
241 |
tctt |
244 |
Q |
| |
|
|||| |
|
|
| T |
39778878 |
tctt |
39778875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University