View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8909_low_53 (Length: 238)
Name: NF8909_low_53
Description: NF8909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8909_low_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 48 - 223
Target Start/End: Complemental strand, 41668372 - 41668201
Alignment:
| Q |
48 |
ggattgcgttataaatgatacctcctagtctcnnnnnnngttcagggtcattatcataacnnnnnnnnnnaaaaataataatagttggggaggggaacnn |
147 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||| ||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
41668372 |
ggattgcgttataaacgatacctcctagtctctttttttgttcatggtcattatcataactttttttttaaaaaataataatgattggggaggggaactt |
41668273 |
T |
 |
| Q |
148 |
nnnnnattaattaaaatggtaacaaacaatgatcattttaccaccatccggaatttgaacattgtacattgaggtt |
223 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41668272 |
tttttattaattaaaatggtaacaa----tgatcattttaccaccatccggaatttgaacattgtacattgaggtt |
41668201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University