View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8910_high_26 (Length: 321)
Name: NF8910_high_26
Description: NF8910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8910_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 18 - 308
Target Start/End: Complemental strand, 25639861 - 25639571
Alignment:
| Q |
18 |
actatttgtacttgcccgttgcttttttcatcttcaatttttaggtcgatttttatctttgatttacaattcttgtaacagttatgttattttaaaaaat |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25639861 |
actatttgtacttgctcgttgcttttttcatcttcaatttttaggtcgatttttatctttgatttacaattcttgtaacagttatgttattttaaaaaat |
25639762 |
T |
 |
| Q |
118 |
aatgtttgatttaggaattcagatttgtagaatttgatgtgattttgacatttcaatttagaatttcagatctagtaaaattcaattccgaatttgatta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
25639761 |
aatgtttgatttaggaattcagatttgtagaatttgatgtgattttgacatttcaatttagaatttcagatctagtaaaattcaattccgaatttgatca |
25639662 |
T |
 |
| Q |
218 |
agaattttagatgtggttggttgttactaataacgctaagtacttcacattgttgagtatctttgtgttgttgcttttgtttttctgatgt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25639661 |
agaattttagatgtggttggttgttactaataacgctaagtacttcacattgttgagtatctttgtgttgttgcttttgttttgctgatgt |
25639571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 227 - 300
Target Start/End: Complemental strand, 42405358 - 42405285
Alignment:
| Q |
227 |
gatgtggttggttgttactaataacgctaagtacttcacattgttgagtatctttgtgttgttgcttttgtttt |
300 |
Q |
| |
|
|||||| ||||||||| ||||||| |||||| ||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
42405358 |
gatgtgattggttgttgctaataatgctaagaacttcacgttgttgagtatctttgtggtgttgcttttgtttt |
42405285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 252 - 289
Target Start/End: Complemental strand, 37399264 - 37399227
Alignment:
| Q |
252 |
gctaagtacttcacattgttgagtatctttgtgttgtt |
289 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
37399264 |
gctaagtacttcacatggttgagtatctctgtgttgtt |
37399227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University