View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8910_high_30 (Length: 280)
Name: NF8910_high_30
Description: NF8910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8910_high_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 43467385 - 43467655
Alignment:
| Q |
1 |
atgtagccaagtggaaattttgcaatgcaactatacatggaaagccaaatgcgacatgttcnnnnnnncttgaaatccttattctcttggaactcgatca |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43467385 |
atgtaaccaagtggaaattttgcaatgcaactatacatggaaagccgaatgcgacatgttcttttttccttgaaatccttattctcttggaactcgatca |
43467484 |
T |
 |
| Q |
101 |
aaactggaagaaatggaaggatgctacactgataaaggaccaagcaccga-----gtatcatgactccataaaatctttgctttgtccttatcatgattg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43467485 |
aaactggaagaaatggaaggatgctacactgataaaggaccaagcaccgagccgagtatcatgactccataaagtctttgctttgtccttatcatgattg |
43467584 |
T |
 |
| Q |
196 |
gctgtgtctactcaatatatcttttgcatgcgtccttaaagatgcatccaatttgtgctggaactgatgtc |
266 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43467585 |
gctgtgtctactaaatatatcttttgcatgcgtccttaaagatgcatccaatttgtgcgggaactgatgtc |
43467655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University