View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8910_high_39 (Length: 203)
Name: NF8910_high_39
Description: NF8910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8910_high_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 22 - 187
Target Start/End: Original strand, 14369125 - 14369285
Alignment:
| Q |
22 |
atatacgttagattaatctcattggacactaatcaaggaagttgatattgacagtgatgagattagtggttaacaaatacataattatataac-ttcaag |
120 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14369125 |
atatacgttagattaatctaattggacactaatcaaggaagttgatattgacagtgatgagattagtggttaacaaatacataattatataactttcaag |
14369224 |
T |
 |
| Q |
121 |
tgataatgataattaaagtaagatgaattaaaagtggggtttggttaggtcaccttgttgcctaagc |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14369225 |
------tgataattaaagtaagatgaattaaaagtggggtttggttaggtcaccttgttgcctaagc |
14369285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University