View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8910_low_45 (Length: 397)

Name: NF8910_low_45
Description: NF8910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8910_low_45
NF8910_low_45
[»] chr8 (7 HSPs)
chr8 (18-377)||(3679377-3679746)
chr8 (108-156)||(16457473-16457521)
chr8 (108-156)||(24995407-24995455)
chr8 (108-156)||(31207374-31207422)
chr8 (111-157)||(32945714-32945760)
chr8 (108-157)||(15906707-15906756)
chr8 (108-156)||(9519520-9519568)
[»] chr3 (7 HSPs)
chr3 (47-179)||(31424196-31424328)
chr3 (20-156)||(24712572-24712706)
chr3 (109-157)||(14193962-14194010)
chr3 (108-156)||(17550978-17551026)
chr3 (108-156)||(19176523-19176571)
chr3 (108-147)||(37123403-37123442)
chr3 (109-156)||(43012397-43012444)
[»] chr4 (4 HSPs)
chr4 (18-182)||(6599930-6600095)
chr4 (110-156)||(30167576-30167622)
chr4 (109-157)||(21387215-21387263)
chr4 (108-156)||(30964462-30964510)
[»] chr6 (7 HSPs)
chr6 (112-179)||(32316393-32316460)
chr6 (69-164)||(34092777-34092872)
chr6 (117-179)||(15487690-15487751)
chr6 (108-138)||(26534749-26534779)
chr6 (108-156)||(3117514-3117562)
chr6 (109-157)||(13423488-13423536)
chr6 (108-156)||(16510313-16510361)
[»] chr7 (8 HSPs)
chr7 (108-156)||(38306282-38306330)
chr7 (108-156)||(10244203-10244251)
chr7 (108-156)||(13311860-13311908)
chr7 (109-156)||(41089760-41089807)
chr7 (107-157)||(11379138-11379188)
chr7 (108-157)||(6716747-6716796)
chr7 (108-157)||(12480907-12480956)
chr7 (69-157)||(2613878-2613966)
[»] scaffold0620 (1 HSPs)
scaffold0620 (69-164)||(8111-8206)
[»] chr2 (4 HSPs)
chr2 (108-157)||(22885144-22885193)
chr2 (108-157)||(4471944-4471993)
chr2 (108-157)||(33788643-33788692)
chr2 (108-156)||(39338877-39338925)
[»] chr1 (7 HSPs)
chr1 (108-157)||(5389432-5389481)
chr1 (108-156)||(31585772-31585820)
chr1 (108-156)||(41920473-41920521)
chr1 (98-157)||(27102202-27102261)
chr1 (108-157)||(17033607-17033656)
chr1 (108-156)||(5459182-5459230)
chr1 (108-156)||(30685916-30685964)
[»] chr5 (3 HSPs)
chr5 (107-156)||(7195251-7195300)
chr5 (325-361)||(26367774-26367810)
chr5 (108-148)||(34378119-34378159)


Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 7)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 18 - 377
Target Start/End: Original strand, 3679377 - 3679746
Alignment:
18 agttgcaagtttgtttggccggttaaggagtcttctccggttgatcgagggtgaggggtactttactgatttgtttctagagtctaactagccgatcact 117  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||  ||||||    
3679377 agttgcaagtttgtttggccggttatggagtcttctccggttgatcgagggtgaggggtactttactgatttgtttctagagtctaactggcttatcact 3679476  T
118 tttgattcgagattgggagtcggtgctttgattcaagtttactttgggataattatggtgttcatctttgatggatc-----------ggtggtggaagc 206  Q
    ||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||           |||||||||||     
3679477 tttgattcgagatcgggagtcggtgctttgattcaagtttgctttgggataattatggtgtttatcttcgatggatcggtggtagagaggtggtggaagt 3679576  T
207 tggctaagcgttggaatatgacatttatcggatgtggctcaaatatagtgatgagtggatgatgtttgatttagaggtgtgtcnnnnnnnggatgagtag 306  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||       |||  |||||    
3679577 tggctaagcgttggaatatgacatttatcgggtgtggctcaaatatagtgatgagtggatgatgtttgatttagaggtgtgtctttttttggacaagtag 3679676  T
307 caggctatgaaactcgatttaggtggtgaagttggttttaatggttgttgttctccataagtgttgaaggt 377  Q
    ||||||||| ||||||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||||    
3679677 caggctatggaactcgatttaggtggtgaagttagttttaatggctgttgttct-cataagtgttgaaggt 3679746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 156
Target Start/End: Complemental strand, 16457521 - 16457473
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    ||||||||||||||||||||||| ||||||| || |||||| |||||||    
16457521 gccgatcacttttgattcgagatcgggagtcagttctttgactcaagtt 16457473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 156
Target Start/End: Complemental strand, 24995455 - 24995407
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    ||||||||||||||||||||||| ||||||| || |||||| |||||||    
24995455 gccgatcacttttgattcgagatcgggagtcagttctttgactcaagtt 24995407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 156
Target Start/End: Complemental strand, 31207422 - 31207374
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    ||||||||||||||||||||||| ||||||| || |||||| |||||||    
31207422 gccgatcacttttgattcgagatcgggagtcagttctttgactcaagtt 31207374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 157
Target Start/End: Complemental strand, 32945760 - 32945714
Alignment:
111 gatcacttttgattcgagattgggagtcggtgctttgattcaagttt 157  Q
    |||||||||||||||||||| |||||||  | |||||||||||||||    
32945760 gatcacttttgattcgagatcgggagtcaattctttgattcaagttt 32945714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 108 - 157
Target Start/End: Original strand, 15906707 - 15906756
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagttt 157  Q
    ||||||||| ||||||||||||| ||||||| || ||||| |||||||||    
15906707 gccgatcacatttgattcgagatcgggagtcagttctttggttcaagttt 15906756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 108 - 156
Target Start/End: Original strand, 9519520 - 9519568
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    |||||||| |||||||||||||| ||||||| || |||||| |||||||    
9519520 gccgatcagttttgattcgagatcgggagtcagttctttgactcaagtt 9519568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 57; Significance: 1e-23; HSPs: 7)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 47 - 179
Target Start/End: Original strand, 31424196 - 31424328
Alignment:
47 gtcttctccggttgatcgagggtgaggggtactttactgatttgtttctagagtctaactagccgatcacttttgattcgagattgggagtcggtgcttt 146  Q
    |||||||||||||||||| ||||||||||| | ||||||||||||||  |||||||     |||| || ||||||||||||||| ||||||| |||||||    
31424196 gtcttctccggttgatcgggggtgaggggtgccttactgatttgttttcagagtctggtaggccggtcgcttttgattcgagatcgggagtcagtgcttt 31424295  T
147 gattcaagtttactttgggataattatggtgtt 179  Q
    ||||||||| | ||||||| ||| | |||||||    
31424296 gattcaagtctcctttgggctaaatttggtgtt 31424328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 20 - 156
Target Start/End: Original strand, 24712572 - 24712706
Alignment:
20 ttgcaagtttgtttggccggttaaggagtcttctccggttgatcgagggtgaggggtactttactgatttgtttctagagtctaactagccgatcacttt 119  Q
    ||||||||||||||||| ||| | || |||||||||||||||||| ||||||||||| | |||||||||||||||| |||| |     |||| ||| |||    
24712572 ttgcaagtttgtttggctggtcatggtgtcttctccggttgatcg-gggtgaggggtgccttactgatttgtttctggagtatggtgggccggtcatttt 24712670  T
120 tgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    | |||||||| | |||||| |||||||||||||||||    
24712671 ttattcgaga-tcggagtcagtgctttgattcaagtt 24712706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 109 - 157
Target Start/End: Original strand, 14193962 - 14194010
Alignment:
109 ccgatcacttttgattcgagattgggagtcggtgctttgattcaagttt 157  Q
    ||||||||||||||||||||||||||||||||| |||||  ||||||||    
14193962 ccgatcacttttgattcgagattgggagtcggttctttggctcaagttt 14194010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 156
Target Start/End: Original strand, 17550978 - 17551026
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    ||||||||||||||||||||||| ||||||| || |||||| |||||||    
17550978 gccgatcacttttgattcgagatcgggagtcagttctttgactcaagtt 17551026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 156
Target Start/End: Original strand, 19176523 - 19176571
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    ||||||||||||||||||||||| ||||||| || |||||| |||||||    
19176523 gccgatcacttttgattcgagatcgggagtcagttctttgactcaagtt 19176571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 108 - 147
Target Start/End: Original strand, 37123403 - 37123442
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttg 147  Q
    ||||||||||||||||||||||||||||||| || |||||    
37123403 gccgatcacttttgattcgagattgggagtcagttctttg 37123442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 109 - 156
Target Start/End: Original strand, 43012397 - 43012444
Alignment:
109 ccgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    |||||||||||||||||||||| ||||||| || |||||| |||||||    
43012397 ccgatcacttttgattcgagatcgggagtcagttctttgactcaagtt 43012444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 50; Significance: 2e-19; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 18 - 182
Target Start/End: Complemental strand, 6600095 - 6599930
Alignment:
18 agttgcaagtttgtttggccggttaaggagtcttctccggttgatcgagggtgaggggtactttactgatttgtttctagagtctaactagccgatcact 117  Q
    ||||||||  |||||||||  |||| || ||||||| |||| ||||||| |||||| | || |||||||||||  ||||||||||     ||||||| ||    
6600095 agttgcaatcttgtttggctagttatggtgtcttcttcggtggatcgagcgtgaggaggaccttactgatttggctctagagtctggtgggccgatcgct 6599996  T
118 tttgattcgagattgggagtcggtgctttgattcaag-tttactttgggataattatggtgttcat 182  Q
    ||||||| ||||| |||||||||| |||||||||||| |||  |||||| || |||||||||||||    
6599995 tttgattagagatcgggagtcggttctttgattcaagttttgttttgggctatttatggtgttcat 6599930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 110 - 156
Target Start/End: Complemental strand, 30167622 - 30167576
Alignment:
110 cgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    ||||||||||||||||||||| |||||||||| |||||| |||||||    
30167622 cgatcacttttgattcgagatcgggagtcggttctttgactcaagtt 30167576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 109 - 157
Target Start/End: Complemental strand, 21387263 - 21387215
Alignment:
109 ccgatcacttttgattcgagattgggagtcggtgctttgattcaagttt 157  Q
    |||||||||||||||||||||| || |||| || ||| |||||||||||    
21387263 ccgatcacttttgattcgagatcggaagtcagttcttcgattcaagttt 21387215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 108 - 156
Target Start/End: Original strand, 30964462 - 30964510
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    ||||||||||||||||||| ||| ||||||| || |||||| |||||||    
30964462 gccgatcacttttgattcgtgatcgggagtccgttctttgactcaagtt 30964510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 44; Significance: 6e-16; HSPs: 7)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 112 - 179
Target Start/End: Original strand, 32316393 - 32316460
Alignment:
112 atcacttttgattcgagattgggagtcggtgctttgattcaagtttactttgggataattatggtgtt 179  Q
    ||||||||||||||||||| || |||  || ||||||||||||||||||||||| |||||||||||||    
32316393 atcacttttgattcgagatcggtagtaagttctttgattcaagtttactttgggctaattatggtgtt 32316460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 69 - 164
Target Start/End: Original strand, 34092777 - 34092872
Alignment:
69 tgaggggtactttactgatttgtttctagagtctaactagccgatcacttttgattcgagattgggagtcggtgctttgattcaagtttactttgg 164  Q
    |||| ||||| |||||||||||| | | ||||||    |||||||||||||||||||||||| || ||||  | ||||||||||||||| ||||||    
34092777 tgagaggtacattactgatttgtctttggagtctggtgagccgatcacttttgattcgagataggaagtctattctttgattcaagtttgctttgg 34092872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 117 - 179
Target Start/End: Original strand, 15487690 - 15487751
Alignment:
117 ttttgattcgagattgggagtcggtgctttgattcaagtttactttgggataattatggtgtt 179  Q
    |||| ||| ||||| ||||||||||| |||||||||||||| ||||||| ||||| |||||||    
15487690 tttttatttgagatcgggagtcggtg-tttgattcaagtttgctttggggtaattttggtgtt 15487751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 108 - 138
Target Start/End: Complemental strand, 26534779 - 26534749
Alignment:
108 gccgatcacttttgattcgagattgggagtc 138  Q
    |||||||||||||||||||||||||||||||    
26534779 gccgatcacttttgattcgagattgggagtc 26534749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 108 - 156
Target Start/End: Original strand, 3117514 - 3117562
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    |||||||||||||||||| |||| ||||||| || |||||| |||||||    
3117514 gccgatcacttttgattcaagatcgggagtcagttctttgactcaagtt 3117562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 109 - 157
Target Start/End: Original strand, 13423488 - 13423536
Alignment:
109 ccgatcacttttgattcgagattgggagtcggtgctttgattcaagttt 157  Q
    |||||||||||||||||||||| | |||||||| |||||  ||||||||    
13423488 ccgatcacttttgattcgagatcgagagtcggttctttggctcaagttt 13423536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 108 - 156
Target Start/End: Complemental strand, 16510361 - 16510313
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    ||||||||||||||||||||||||| ||||| || |||| | |||||||    
16510361 gccgatcacttttgattcgagattgagagtcagttcttttactcaagtt 16510313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 37; Significance: 0.000000000009; HSPs: 8)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 108 - 156
Target Start/End: Original strand, 38306282 - 38306330
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    ||||||||||||||||||||||||||||||| || |||||| |||||||    
38306282 gccgatcacttttgattcgagattgggagtcagttctttgactcaagtt 38306330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 156
Target Start/End: Original strand, 10244203 - 10244251
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    ||||||||||||||||||||||| ||||||| || |||||| |||||||    
10244203 gccgatcacttttgattcgagatcgggagtcagttctttgactcaagtt 10244251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 156
Target Start/End: Original strand, 13311860 - 13311908
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    ||||||||||||||||||||||| ||||||| || ||||| ||||||||    
13311860 gccgatcacttttgattcgagatcgggagtcagttctttggttcaagtt 13311908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 109 - 156
Target Start/End: Complemental strand, 41089807 - 41089760
Alignment:
109 ccgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    |||||||||||||||||||||||||||||| |  |||||| |||||||    
41089807 ccgatcacttttgattcgagattgggagtcagctctttgactcaagtt 41089760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 107 - 157
Target Start/End: Complemental strand, 11379188 - 11379138
Alignment:
107 agccgatcacttttgattcgagattgggagtcggtgctttgattcaagttt 157  Q
    |||||||| ||||||||||||||| ||||||| || ||||| |||||||||    
11379188 agccgatcgcttttgattcgagatcgggagtcagtactttggttcaagttt 11379138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 108 - 157
Target Start/End: Complemental strand, 6716796 - 6716747
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagttt 157  Q
    ||||||||||||||||||||||| ||||||| || |||||  ||||||||    
6716796 gccgatcacttttgattcgagatcgggagtcagttctttggctcaagttt 6716747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 108 - 157
Target Start/End: Original strand, 12480907 - 12480956
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagttt 157  Q
    ||||||| ||||||||||||||| ||||||| || ||||| |||||||||    
12480907 gccgatcgcttttgattcgagatcgggagtcagttctttggttcaagttt 12480956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 69 - 157
Target Start/End: Complemental strand, 2613966 - 2613878
Alignment:
69 tgaggggtactttactgatttgtttctagagtctaactagccgatcacttttgattcgagattgggagtcggtgctttgattcaagttt 157  Q
    |||||||||| |||||||||||  ||| || |||   | ||| ||||||||||||||||||| || |||  |||| |||||||||||||    
2613966 tgaggggtaccttactgatttgagtctggaatctggttggccaatcacttttgattcgagatcggaagttagtgccttgattcaagttt 2613878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0620 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0620
Description:

Target: scaffold0620; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 69 - 164
Target Start/End: Original strand, 8111 - 8206
Alignment:
69 tgaggggtactttactgatttgtttctagagtctaactagccgatcacttttgattcgagattgggagtcggtgctttgattcaagtttactttgg 164  Q
    |||| ||||| |||||||||||| | | ||||||    |||||||||||||||||||||||| || ||||  | ||||||||||||||| ||||||    
8111 tgagaggtacattactgatttgtctttggagtctggtgagccgatcacttttgattcgagataggaagtctattctttgattcaagtttgctttgg 8206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000006; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 108 - 157
Target Start/End: Complemental strand, 22885193 - 22885144
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagttt 157  Q
    ||||||||||||||||||||||| ||||||| || ||||| |||||||||    
22885193 gccgatcacttttgattcgagatcgggagtcagttctttggttcaagttt 22885144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 108 - 157
Target Start/End: Original strand, 4471944 - 4471993
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagttt 157  Q
    ||||||| | ||||||||||||| ||||||| || |||||||||||||||    
4471944 gccgatcgcctttgattcgagatcgggagtcagttctttgattcaagttt 4471993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 108 - 157
Target Start/End: Complemental strand, 33788692 - 33788643
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagttt 157  Q
    ||||||| ||||||||||||||||||||||| || ||||| |||| ||||    
33788692 gccgatcgcttttgattcgagattgggagtcagttctttggttcaggttt 33788643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 108 - 156
Target Start/End: Complemental strand, 39338925 - 39338877
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    ||||||| ||||||||||||||| ||||||| || |||||| |||||||    
39338925 gccgatcgcttttgattcgagatcgggagtcagttctttgactcaagtt 39338877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000006; HSPs: 7)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 108 - 157
Target Start/End: Complemental strand, 5389481 - 5389432
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagttt 157  Q
    ||||||||||||||||||||||| ||||||| || |||||| ||||||||    
5389481 gccgatcacttttgattcgagatcgggagtcagttctttgactcaagttt 5389432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 156
Target Start/End: Complemental strand, 31585820 - 31585772
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    ||||||||||||||||||||||| ||||||| || |||||| |||||||    
31585820 gccgatcacttttgattcgagatcgggagtcagttctttgactcaagtt 31585772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 156
Target Start/End: Original strand, 41920473 - 41920521
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    ||||||||||||||||||||||| ||||||| || |||||| |||||||    
41920473 gccgatcacttttgattcgagatcgggagtcagttctttgactcaagtt 41920521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 98 - 157
Target Start/End: Original strand, 27102202 - 27102261
Alignment:
98 agtctaactagccgatcacttttgattcgagattgggagtcggtgctttgattcaagttt 157  Q
    ||||||||  ||||||||||||||||||||||| ||||||| || |||||  ||||||||    
27102202 agtctaacgggccgatcacttttgattcgagatcgggagtcagttctttggatcaagttt 27102261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 108 - 157
Target Start/End: Original strand, 17033607 - 17033656
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagttt 157  Q
    ||||||||||||||| ||||||| ||||||| || ||||| |||||||||    
17033607 gccgatcacttttgaatcgagatcgggagtcagttctttggttcaagttt 17033656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 108 - 156
Target Start/End: Original strand, 5459182 - 5459230
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    ||||||||||||||||||||||| |||||||  |  |||||||||||||    
5459182 gccgatcacttttgattcgagatcgggagtcaattatttgattcaagtt 5459230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 108 - 156
Target Start/End: Complemental strand, 30685964 - 30685916
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    ||||||||||||||||| ||||| ||||||| || |||||| |||||||    
30685964 gccgatcacttttgatttgagatcgggagtcagttctttgactcaagtt 30685916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 107 - 156
Target Start/End: Complemental strand, 7195300 - 7195251
Alignment:
107 agccgatcacttttgattcgagattgggagtcggtgctttgattcaagtt 156  Q
    |||||||||||||||||||||||| ||||||| || |||||  |||||||    
7195300 agccgatcacttttgattcgagatcgggagtcagttctttggctcaagtt 7195251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 325 - 361
Target Start/End: Complemental strand, 26367810 - 26367774
Alignment:
325 ttaggtggtgaagttggttttaatggttgttgttctc 361  Q
    ||||||||||||||||| ||| |||||||||||||||    
26367810 ttaggtggtgaagttggatttgatggttgttgttctc 26367774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 108 - 148
Target Start/End: Original strand, 34378119 - 34378159
Alignment:
108 gccgatcacttttgattcgagattgggagtcggtgctttga 148  Q
    ||||||||||||||||||||||| ||||||| || ||||||    
34378119 gccgatcacttttgattcgagatcgggagtcagttctttga 34378159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University