View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8910_low_84 (Length: 245)
Name: NF8910_low_84
Description: NF8910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8910_low_84 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 3418289 - 3418086
Alignment:
| Q |
1 |
tcaaggcacacagtagataatttgagtgttgttttctaattctttattattatttgagtgtttatagtttatannnnnnn-acgtaaaataaatttagag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3418289 |
tcaaggcacacagtagataatttgagtgttgttttctaattctttattattatttgagtgtttatagtttatattttttttacgtaaaataaatttagag |
3418190 |
T |
 |
| Q |
100 |
agaagggatgatgtttcaatctaaagtaggatattgttcgaataatcaactacaacattaactagaagtatctcatcttcgcatttgtttttatgactga |
199 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3418189 |
agaaggaatgatgtttcaatctaaagtaggatattgttcgtataatcatctataacattaactagaagtatctcatcttcgcatttgtttttatgactga |
3418090 |
T |
 |
| Q |
200 |
tatt |
203 |
Q |
| |
|
|||| |
|
|
| T |
3418089 |
tatt |
3418086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University