View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8910_low_87 (Length: 239)
Name: NF8910_low_87
Description: NF8910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8910_low_87 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 2 - 224
Target Start/End: Original strand, 32805011 - 32805233
Alignment:
| Q |
2 |
ttcaaccattatctgaaacaccctaaaccctaggtcaactacaattaatgtcaatcaagtagtcgaggattcaaaatgtaaaaccaacgttcttctcgat |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32805011 |
ttcaaccattatctgaaacaccctaaaccctaggtcaactacagttaatgtcaatcaagcagccgaggattcaaaatgtaaaaccaacgttcttcttgat |
32805110 |
T |
|
| Q |
102 |
tcctagaatagatgaaatagtgcctctcaggctcccattaacattaaggtttatacctttaatgaaactaatatataatcaacaaaaattgtcagatgat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32805111 |
tcctagaatagatgaaatagtgcctctcaggctcccattaacattaaggtttatacctttaatgaaactaatatataatcaacaaaaattgtcagatgat |
32805210 |
T |
|
| Q |
202 |
cctaggtttctaacatgaaaggt |
224 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32805211 |
cctaggtttctaacatgaaaggt |
32805233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University