View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8910_low_89 (Length: 235)
Name: NF8910_low_89
Description: NF8910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8910_low_89 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 14 - 130
Target Start/End: Complemental strand, 27799928 - 27799810
Alignment:
| Q |
14 |
actacaacatcgacatctcttctct--acatgcccaagcttagtttccaccattctttctactatagtgtgaattctcaaaccaagacaaggattttaaa |
111 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27799928 |
actacaacatctacatctcttctctctacatgcccaagcttagtttccaccattctttctactatagtgtgaattctcaaaccaagacaaggattttaaa |
27799829 |
T |
|
| Q |
112 |
tgttttcattgttaggttt |
130 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
27799828 |
tgttttcattgttaggttt |
27799810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 195 - 235
Target Start/End: Complemental strand, 27799745 - 27799705
Alignment:
| Q |
195 |
tataaaagcttacaactttataccttgaaaatgaaaaccct |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27799745 |
tataaaagcttacaactttataccttgaaaatgaaaaccct |
27799705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University