View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8910_low_93 (Length: 222)
Name: NF8910_low_93
Description: NF8910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8910_low_93 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 32147057 - 32146847
Alignment:
| Q |
1 |
ccaaccacaatacacacccttaggatacctcaaatttacacaagtaatgctacaatttcgatcgtcatttggacatggca---ctttgcactaatacttt |
97 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32147057 |
ccaaccgcaatacacacccttaggatacctcaaatttacacaagtgatactacaatttcgatcgtcatttggacatggcagcactttgcactaatacttt |
32146958 |
T |
|
| Q |
98 |
ttgtgcagaaatgtctggttcaaaacaattgataagattttataacttggaaccaaggatggtgataccttggttttaaccttgcctaatactttttcat |
197 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32146957 |
ttgtgaagaaatgtctggttcaaaacaattgatgagattttataacttggaaccaaggttggtgataccttggttttaaccttgcctaatactttttcat |
32146858 |
T |
|
| Q |
198 |
gtacttgatgt |
208 |
Q |
| |
|
||||||||||| |
|
|
| T |
32146857 |
gtacttgatgt |
32146847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 208
Target Start/End: Complemental strand, 32155879 - 32155806
Alignment:
| Q |
140 |
taacttggaaccaaggatggtgataccttgg-ttttaaccttgcctaat----actttttcatgtacttgatgt |
208 |
Q |
| |
|
|||||||||||||| | |||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
32155879 |
taacttggaaccaaagttggtgataccttggtttttttccttgcctaatactcactttttcatgtacttgatgt |
32155806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 85
Target Start/End: Complemental strand, 42255712 - 42255643
Alignment:
| Q |
15 |
cacccttaggatacctcaaatttacacaagtaatgctacaatttcgatcgtcatttggacatggcactttg |
85 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||| |||||| || | |||||||||||||||||| ||||| |
|
|
| T |
42255712 |
cacccttaagatacctcaaatttatgcaagtaacactacaactt-gctcgtcatttggacatggccctttg |
42255643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University