View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8911_low_102 (Length: 268)
Name: NF8911_low_102
Description: NF8911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8911_low_102 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 8093109 - 8092854
Alignment:
| Q |
1 |
ctgccatatctgctgtcatgggttctcaaaggcttccattccccaacggcgtttttgatcttattcattgtgcacgttgtcgagtaccttggcatgaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8093109 |
ctgccatatctgctgtcatgggttctcaaaggcttccattccccaacggcgtttttgatcttattcattgtgcacgttgtcgagtaccttggcatgaaga |
8093010 |
T |
 |
| Q |
101 |
aggttggtatctgtaatgtttatgctgggctagatttttcatttggttgagcatggttaatgaggaatatgaaacttcgtttttaggtggcaagctgcta |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8093009 |
aggttggtatcagtaatgtttatgctgggctagatttttcatttggttgagcatggttaataaggaatatgaaacttcgtttttaggtggcaagctgcta |
8092910 |
T |
 |
| Q |
201 |
ttggaattgaatcgggttttgcgaccaggtggttattttgcttggtctgctactcc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8092909 |
ttggaattgaatcgggttttgcgaccaggtggttattttgcttggtctgctactcc |
8092854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 6 - 106
Target Start/End: Original strand, 32508009 - 32508109
Alignment:
| Q |
6 |
atatctgctgtcatgggttctcaaaggcttccattccccaacggcgtttttgatcttattcattgtgcacgttgtcgagtaccttggcatgaagaaggtt |
105 |
Q |
| |
|
|||||||||||||||||| |||||||| | | |||||| | | | || || |||||||| |||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
32508009 |
atatctgctgtcatgggtactcaaaggttgcaattcccaagccgtgtcttcgatcttatacattgtgcgcgatgtcgagtaccttggcatgaagaaggtt |
32508108 |
T |
 |
| Q |
106 |
g |
106 |
Q |
| |
|
| |
|
|
| T |
32508109 |
g |
32508109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 256
Target Start/End: Original strand, 32508199 - 32508271
Alignment:
| Q |
184 |
taggtggcaagctgctattggaattgaatcgggttttgcgaccaggtggttattttgcttggtctgctactcc |
256 |
Q |
| |
|
||||||| ||| |||| ||||||||||| |||||| | |||||||||||| ||||| |||||||| ||||| |
|
|
| T |
32508199 |
taggtggtaagttgcttttggaattgaaccgggttcttagaccaggtggtttttttgtatggtctgccactcc |
32508271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University