View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8911_low_105 (Length: 255)
Name: NF8911_low_105
Description: NF8911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8911_low_105 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 2041306 - 2041529
Alignment:
| Q |
19 |
gtttgatcctttcttttcatcataacaggattcctttgaaacaaaagcagtgatgatgatggcttctttctcgcagatacttcatcccttctcatcgtaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2041306 |
gtttgatcctttcttttcatcataacaggattcctttgaaacaaaagcaccgatgatgatggcttctttctcgcagatacttcgtcccttctcatcgtaa |
2041405 |
T |
 |
| Q |
119 |
tagcaagtttccttcgaaacaaaagcagtggatcgaaaacaaaggaacaaaaactcaatgagtaaaagtattagatatgtttttcactgcaaccctaatg |
218 |
Q |
| |
|
|||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2041406 |
tagctagattccttcgaaacaaaagcagtggatcgaaaacaaaggaacaaaaactcaatgagtaaaagtattagatatgtttttcactgcaaccctaatg |
2041505 |
T |
 |
| Q |
219 |
gattttaacctatatatagtataa |
242 |
Q |
| |
|
| |||||||||||||||||||||| |
|
|
| T |
2041506 |
gcttttaacctatatatagtataa |
2041529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 19 - 120
Target Start/End: Complemental strand, 1352351 - 1352250
Alignment:
| Q |
19 |
gtttgatcctttcttttcatcataacaggattcctttgaaacaaaagcagtgatgatgatggcttctttctcgcagatacttcatcccttctcatcgtaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |||||| ||||||||| ||| |
|
|
| T |
1352351 |
gtttgatcctttcttttcatcataacaggattcctttgaaacaaaagcaccgatgatgatggcttccttctcgcagatatttcatctcttctcatcataa |
1352252 |
T |
 |
| Q |
119 |
ta |
120 |
Q |
| |
|
|| |
|
|
| T |
1352251 |
ta |
1352250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 120
Target Start/End: Complemental strand, 36717384 - 36717295
Alignment:
| Q |
19 |
gtttgatcctttcttttcatcataacaggattcctttgaaacaaaagcagtgatgatgatggcttctttctcgcagatacttcatcccttctcatcgtaa |
118 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| | |||||||||||||| ||||||| |||||||||||||||| ||| |
|
|
| T |
36717384 |
gtttgatcctttctcttcatcataacaggattcctttgaaaca------------acgatggcttctttcttgcagatatttcatcccttctcatcataa |
36717297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University