View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8911_low_119 (Length: 204)
Name: NF8911_low_119
Description: NF8911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8911_low_119 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 54 - 192
Target Start/End: Complemental strand, 35552064 - 35551924
Alignment:
| Q |
54 |
acaacatgtgctcaaaaaatgt--ggtaaatgagatttaaataatatgcttatgctttctctctactattccattttgatgaggggttgcaacacatgaa |
151 |
Q |
| |
|
|||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35552064 |
acaacatgtgctaaaaaaatatttggtaaatgagatttaaataatatgcttatgctttctctctactattccattttgatgaggggttgcaacacatgaa |
35551965 |
T |
|
| Q |
152 |
gtttgatgtaaaatttcattttccgagtaaaagtctctgct |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35551964 |
gtttgatgtaaaatttcattttccgagtaaaagtctttgct |
35551924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 107 - 173
Target Start/End: Original strand, 7801007 - 7801073
Alignment:
| Q |
107 |
tttctctctactattccattttgatgaggggttgcaacacatgaagtttgatgtaaaatttcatttt |
173 |
Q |
| |
|
||||||||||||||||||||||| || || ||| ||||| | |||||||||||| |||| |||||| |
|
|
| T |
7801007 |
tttctctctactattccattttgttgtggtgttccaacataccaagtttgatgtataattccatttt |
7801073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University