View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8911_low_15 (Length: 733)
Name: NF8911_low_15
Description: NF8911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8911_low_15 |
 |  |
|
| [»] scaffold1024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 533; Significance: 0; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 533; E-Value: 0
Query Start/End: Original strand, 17 - 722
Target Start/End: Complemental strand, 1787361 - 1786650
Alignment:
| Q |
17 |
acatcagtctattttctttgtatctatacaaactagatttactacgctcaacaaaagtacgcagtcacgcattcaggataatcttgatt---cgatcaag |
113 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1787361 |
acatcactctattttctttgtatctatacaaactagatttattacggtcaacaaaagtacgcagtcacgcattcaggataatcttgattgttcgatcaag |
1787262 |
T |
 |
| Q |
114 |
atgaccattcaattaagattagacgatttccgatatcagactatgtgaatgtgggttc-tcctaattgcaggaaccctagtcttgtgtggtcacaaacat |
212 |
Q |
| |
|
||||||||||||| ||||| |||||||| || ||||||||||| |||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1787261 |
atgaccattcaatcaagatcagacgattcccaatatcagactacgtgaatgtgggttcctcctaattgcaggaaccctagtcttgtatggtcacaaacat |
1787162 |
T |
 |
| Q |
213 |
ttagatacaccatttagtcacatatacaagtcttatgtggtcacaaacattttgatacatacaccatttaatcacaaatacatatttgaaaaagttataa |
312 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1787161 |
ttagatacatcatttagtcacatatacaagtcttatgtggtcacaaacattttgatacatacaccatttaatcacaaatacatatttgaaaaagttataa |
1787062 |
T |
 |
| Q |
313 |
aaaataaaagaattgaataaagtacannnnnnnaggaaagaaaaatatagttacacctaagtattttccgaatatattgtctttacatttttaattcaaa |
412 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1787061 |
aaaataaaagaattgaataaagtacatttttttaggaaagaaaaatatagttatacctaagtattttccgaatatattgtctttacatttttaattcaaa |
1786962 |
T |
 |
| Q |
413 |
ctaacttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccaccctttttgtaaccnnnnnnnctaacacaaga |
512 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
1786961 |
ctaacttggacgagagtagtattaggatgggtgaccttctggtaagtctttgtgttgcacctctcccaccctttgtgtaaccaaaaaaactaacacaaga |
1786862 |
T |
 |
| Q |
513 |
cttcttttaccacaattattaatctacatgtcatgttgtaccaaaaccgcaaatta--atatatgtttcgattactagtgaatttgacaaaattacggta |
610 |
Q |
| |
|
|| |||||||||||||||||||||||| |||||||| ||||||||||| |||||| |||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
1786861 |
ctccttttaccacaattattaatctacgtgtcatgtcgtaccaaaaccaaaaattagtatatatgtttcgattactagtgaatttgacaaaatttcgata |
1786762 |
T |
 |
| Q |
611 |
tcacatttttaacaaaatcacggtgtcatcatataattctgtcaactttatggcaattctaagcattatactcaatgtgtttaagatgttaataaagatt |
710 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
1786761 |
tcacaattttaacaaaatcaaggtgtcatcatataattctgtcaactttatggcaattctaagcattgtactcaatttgtttaagatgttaataaagatt |
1786662 |
T |
 |
| Q |
711 |
gaccttgatgtc |
722 |
Q |
| |
|
|||||||||||| |
|
|
| T |
1786661 |
gaccttgatgtc |
1786650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 417 - 482
Target Start/End: Original strand, 18860049 - 18860114
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacc |
482 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
18860049 |
cttgggcgagagtagtactaggatgggtgacctcctggaaagtccttgtgttgcacctctcccacc |
18860114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 16477145 - 16477086
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16477145 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
16477086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 60; Significance: 3e-25; HSPs: 42)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 417 - 488
Target Start/End: Complemental strand, 12178979 - 12178908
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12178979 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctctcccaccattttt |
12178908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 417 - 488
Target Start/End: Complemental strand, 12184363 - 12184292
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12184363 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctctcccaccattttt |
12184292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 417 - 488
Target Start/End: Complemental strand, 12189698 - 12189627
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12189698 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctctcccaccattttt |
12189627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 56; E-Value: 8e-23
Query Start/End: Original strand, 417 - 488
Target Start/End: Complemental strand, 12172509 - 12172438
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
12172509 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtattgcacctctcccaccgttttt |
12172438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 56; E-Value: 8e-23
Query Start/End: Original strand, 417 - 488
Target Start/End: Complemental strand, 12182459 - 12182388
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12182459 |
cttgggcgagagtaggactaggatgggtgacctcctgggaagtccttgtgttgcacctctcccaccattttt |
12182388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 56; E-Value: 8e-23
Query Start/End: Original strand, 417 - 488
Target Start/End: Complemental strand, 12189354 - 12189283
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
||||||||||||||||| |||||||| |||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12189354 |
cttgggcgagagtagtactaggatggatgacctcctgggaagtccttgtgttgcacctctcccaccattttt |
12189283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 417 - 486
Target Start/End: Complemental strand, 12180542 - 12180473
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
486 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
12180542 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgtttaacctctcccacccttt |
12180473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 417 - 486
Target Start/End: Complemental strand, 12180880 - 12180811
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
486 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||| |||||||||||||||||||||||||| |||| |
|
|
| T |
12180880 |
cttgggcgagagtagtactaggatgggtgacctcctggaaagtccttgtgttgcacctctcccacgcttt |
12180811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 417 - 486
Target Start/End: Complemental strand, 12182116 - 12182047
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
486 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
12182116 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgtttaacctctcccacccttt |
12182047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 480
Target Start/End: Complemental strand, 12169537 - 12169474
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctccca |
480 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12169537 |
cttgggcgagagtagttctaggatgggtgaccttttgggaagtccttgtgttgcacctctccca |
12169474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 488
Target Start/End: Complemental strand, 12177399 - 12177328
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
12177399 |
cttgggcgagagtagtactaggatgggtgaccacctgggaagtccttgtattgcacctctcccaccattttt |
12177328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 422 - 488
Target Start/End: Complemental strand, 12169217 - 12169151
Alignment:
| Q |
422 |
gcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
12169217 |
gcgagagtagtactaggatgggtgacctcctgggaagtccttgtattgcacctctcccacctttttt |
12169151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 417 - 488
Target Start/End: Complemental strand, 12173175 - 12173104
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
12173175 |
cttgggcgagagtagtactaggatgggtgacctcctaggaagtccttgtattgcacatctcccaccattttt |
12173104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 417 - 488
Target Start/End: Complemental strand, 12185025 - 12184954
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||| |||||| |||||| |||||||||||||||||| ||||| |
|
|
| T |
12185025 |
cttgggcgagagtagtactaggatgggtggcctcctgggaggtccttttgttgcacctctcccaccattttt |
12184954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 417 - 488
Target Start/End: Complemental strand, 12185369 - 12185298
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
||||||||||||||||| |||||||||| ||| || ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12185369 |
cttgggcgagagtagtacaaggatgggtgtcctcctaggaagtccttgtgttgcacctctcccaccattttt |
12185298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 417 - 488
Target Start/End: Complemental strand, 12186674 - 12186603
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
||||||||||||||||| |||||||||| ||| ||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
12186674 |
cttgggcgagagtagtacgaggatgggtgtcctcctgagaagtccttgtgttgcacctctcccaccattttt |
12186603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 417 - 488
Target Start/End: Complemental strand, 12187017 - 12186946
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||| |||||| |||||| |||||||||||||||||| ||||| |
|
|
| T |
12187017 |
cttgggcgagagtagtactaggatgggtggcctcctgggaggtccttttgttgcacctctcccaccattttt |
12186946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 417 - 488
Target Start/End: Complemental strand, 12187361 - 12187290
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
||||||||||||||||| |||||||||| ||| || ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12187361 |
cttgggcgagagtagtacaaggatgggtgtcctcctaggaagtccttgtgttgcacctctcccaccattttt |
12187290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 417 - 488
Target Start/End: Complemental strand, 12188668 - 12188597
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
||||||||||||||||| |||||||||| ||| ||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
12188668 |
cttgggcgagagtagtacgaggatgggtgtcctcctgagaagtccttgtgttgcacctctcccaccattttt |
12188597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 420 - 486
Target Start/End: Complemental strand, 12170123 - 12170057
Alignment:
| Q |
420 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
486 |
Q |
| |
|
|||||||||||||| || |||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12170123 |
gggcgagagtagtactatgatgggtgacctcttgggaagtccttgtgttgcacctctcccatccttt |
12170057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 417 - 479
Target Start/End: Complemental strand, 12189011 - 12188949
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctccc |
479 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
12189011 |
cttgggcgagagtagttctaggatgggtgacctcctgggaagttcttgtgttgcacctctccc |
12188949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 417 - 486
Target Start/End: Complemental strand, 12172834 - 12172765
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
486 |
Q |
| |
|
||||||||||||||||| |||||||| |||||| ||||| ||||||||| ||| |||||||||||||||| |
|
|
| T |
12172834 |
cttgggcgagagtagtactaggatggatgacctcctgggtagtccttgtattgaacctctcccacccttt |
12172765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 417 - 486
Target Start/End: Complemental strand, 12174184 - 12174115
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
486 |
Q |
| |
|
||||||||||||||||| |||||||| |||||| |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
12174184 |
cttgggcgagagtagtactaggatggatgacctcctggaaagtccttgtgtttaacctctcccacccttt |
12174115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 417 - 486
Target Start/End: Complemental strand, 12174850 - 12174781
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
486 |
Q |
| |
|
||||||||||||||||| |||||||| ||| || ||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
12174850 |
cttgggcgagagtagtactaggatggatgatctcctgggtagtccttgtgttgaacctctcccacccttt |
12174781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 417 - 486
Target Start/End: Complemental strand, 12178636 - 12178567
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
486 |
Q |
| |
|
||||||||||||||||| || |||||||| ||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
12178636 |
cttgggcgagagtagtactatgatgggtgtcctcctgggaagtccttgtgtttaacctctcccacccttt |
12178567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 417 - 486
Target Start/End: Complemental strand, 12184019 - 12183950
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
486 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| || ||||||||||||||| |||||||||||||||| |
|
|
| T |
12184019 |
cttggacgagagtagtactaggatgggtgacctccttggaagtccttgtgtttaacctctcccacccttt |
12183950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 417 - 486
Target Start/End: Complemental strand, 12184683 - 12184614
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
486 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||| |||||||||||||||||||||| ||| |||| |
|
|
| T |
12184683 |
cttgggcgagagtagtaccaggatgggtgacctcctggaaagtccttgtgttgcacctctctcacgcttt |
12184614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 417 - 488
Target Start/End: Complemental strand, 12174525 - 12174454
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
||||||||||||||||| ||||||||||||| | || |||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
12174525 |
cttgggcgagagtagtactaggatgggtgacgtcctaggaagtccttgtattgcacatctcccaccattttt |
12174454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 417 - 486
Target Start/End: Complemental strand, 12173843 - 12173774
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
486 |
Q |
| |
|
|||||||| |||||||| |||||||| |||||| |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
12173843 |
cttgggcgggagtagtactaggatggatgacctcctggaaagtccttgtgtttaacctctcccacccttt |
12173774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 417 - 486
Target Start/End: Complemental strand, 12179303 - 12179234
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
486 |
Q |
| |
|
||||||||||||||||| | ||||| |||||| ||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
12179303 |
cttgggcgagagtagtactttgatggatgacctcctgggaagtccttgtgttgaacctctcccacgcttt |
12179234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 417 - 478
Target Start/End: Complemental strand, 12182783 - 12182722
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcc |
478 |
Q |
| |
|
||||||||||||||||| | |||||| |||||| ||||||||||||||||||| |||||||| |
|
|
| T |
12182783 |
cttgggcgagagtagtacttggatggatgacctcctgggaagtccttgtgttgaacctctcc |
12182722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 418 - 486
Target Start/End: Complemental strand, 12173501 - 12173433
Alignment:
| Q |
418 |
ttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
486 |
Q |
| |
|
|||||||||||||||| |||||||| ||| || ||||| |||||||||| || |||||||||||||||| |
|
|
| T |
12173501 |
ttgggcgagagtagtactaggatggatgatctcctgggtagtccttgtgctgaacctctcccacccttt |
12173433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 417 - 486
Target Start/End: Complemental strand, 12175192 - 12175124
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttt |
486 |
Q |
| |
|
|||||||| |||||||| |||||||| |||| | |||||||||||||||||| |||||||||||||||| |
|
|
| T |
12175192 |
cttgggcgggagtagtactaggatggatgac-tcctgggaagtccttgtgtttaacctctcccacccttt |
12175124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 417 - 488
Target Start/End: Complemental strand, 12177058 - 12176985
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttct---gggaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| || ||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
12177058 |
cttggacgagagtagtactaggatgggtgacct-ctagggggaagtccttttgttgcacctctcccaccattttt |
12176985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 420 - 470
Target Start/End: Complemental strand, 12170711 - 12170661
Alignment:
| Q |
420 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgc |
470 |
Q |
| |
|
|||||||||||||| || |||||||||||| |||||||||| ||||||||| |
|
|
| T |
12170711 |
gggcgagagtagtactatgatgggtgacctcctgggaagtcattgtgttgc |
12170661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 420 - 469
Target Start/End: Complemental strand, 12169828 - 12169779
Alignment:
| Q |
420 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttg |
469 |
Q |
| |
|
|||||||||||||| || |||||||||||| |||||||||| |||||||| |
|
|
| T |
12169828 |
gggcgagagtagtactatgatgggtgacctcctgggaagtcattgtgttg |
12169779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 417 - 475
Target Start/End: Complemental strand, 4375037 - 4374979
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctc |
475 |
Q |
| |
|
|||| |||||||||||| ||||||| ||||| | || |||| ||||||||||||||||| |
|
|
| T |
4375037 |
cttgtgcgagagtagtaataggatgtgtgacttcctaggaaatccttgtgttgcacctc |
4374979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 420 - 470
Target Start/End: Complemental strand, 12170417 - 12170367
Alignment:
| Q |
420 |
gggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgc |
470 |
Q |
| |
|
|||||||||||||| || |||||||||||| || ||||||| ||||||||| |
|
|
| T |
12170417 |
gggcgagagtagtactatgatgggtgacctcctaggaagtcattgtgttgc |
12170367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 451 - 488
Target Start/End: Complemental strand, 12185678 - 12185641
Alignment:
| Q |
451 |
ctgggaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
12185678 |
ctgggaagtccttgtgtcgcacctctcccaccattttt |
12185641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 451 - 488
Target Start/End: Complemental strand, 12187670 - 12187633
Alignment:
| Q |
451 |
ctgggaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
12187670 |
ctgggaagtccttgtgtcgcacctctcccaccattttt |
12187633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 451 - 484
Target Start/End: Original strand, 17817947 - 17817980
Alignment:
| Q |
451 |
ctgggaagtccttgtgttgcacctctcccaccct |
484 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
17817947 |
ctgggaagtccttgtgttgcacctatcccaccct |
17817980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 455 - 488
Target Start/End: Complemental strand, 19156159 - 19156126
Alignment:
| Q |
455 |
gaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
19156159 |
gaagtccttgtgttgcacctctcccaccattttt |
19156126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 2e-20; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Original strand, 21825765 - 21825824
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21825765 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
21825824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 418 - 477
Target Start/End: Complemental strand, 25904789 - 25904730
Alignment:
| Q |
418 |
ttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctc |
477 |
Q |
| |
|
|||| |||||||||||||| ||||| ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
25904789 |
ttggacgagagtagtattaagatggatgaccttttggaaagtccttgtgttgcacctctc |
25904730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 2e-20; HSPs: 51)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24621752 - 24621693
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24621752 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24621693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24622071 - 24622012
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24622071 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24622012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24622390 - 24622331
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24622390 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24622331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24622674 - 24622615
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24622674 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24622615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24622958 - 24622899
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24622958 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24622899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24623561 - 24623502
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24623561 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24623502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24623880 - 24623821
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24623880 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24623821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24624473 - 24624414
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24624473 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24624414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24624792 - 24624733
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24624792 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24624733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24625076 - 24625017
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24625076 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24625017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24625395 - 24625336
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24625395 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24625336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24626968 - 24626909
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24626968 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24626909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24631454 - 24631395
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24631454 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24631395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24631773 - 24631714
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24631773 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24631714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24632057 - 24631998
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24632057 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24631998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24632341 - 24632282
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24632341 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24632282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24632660 - 24632601
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24632660 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24632601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24632944 - 24632885
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24632944 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24632885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24633228 - 24633169
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24633228 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24633169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24633547 - 24633488
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24633547 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24633488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24633866 - 24633807
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24633866 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24633807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24634150 - 24634091
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24634150 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24634091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24634753 - 24634694
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24634753 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24634694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24638832 - 24638773
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24638832 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24638773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24639151 - 24639092
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24639151 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24639092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24623277 - 24623218
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24623277 |
cttgggcgagagtagtnctaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24623218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24627287 - 24627228
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24627287 |
cttgggcgagagtagtnctaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24627228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24627571 - 24627512
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
24627571 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtcnttgtgttgcacctct |
24627512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24631170 - 24631111
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24631170 |
cttgggcgagagtagtactaggatgggtgacctcntgggaagtccttgtgttgcacctct |
24631111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24626037 - 24625978
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
24626037 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccttgttttgcacctct |
24625978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24634469 - 24634410
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24634469 |
cttgggcgagagtagtgctaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24634410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24638513 - 24638454
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24638513 |
cttgggcgagagtagtgctaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24638454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 423 - 476
Target Start/End: Complemental strand, 24626351 - 24626298
Alignment:
| Q |
423 |
cgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24626351 |
cgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24626298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 3348119 - 3348060
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
3348119 |
cttggacgagagtagtactaggatgggtgacctcctaggaagtccttgtgttgcacctct |
3348060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 423 - 476
Target Start/End: Complemental strand, 24637890 - 24637837
Alignment:
| Q |
423 |
cgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
24637890 |
cgagagtagtactaggatgggtgacctcctgggaagtccttgttttgcacctct |
24637837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24619674 - 24619612
Alignment:
| Q |
417 |
cttgggcgagagtagtattag---gatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24619674 |
cttgggcgagagtagtactagntggatgggtgacctcctgggaagtccttgtgttgcacctct |
24619612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24620822 - 24620760
Alignment:
| Q |
417 |
cttgggcgagagtagtattag---gatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24620822 |
cttgggcgagagtagtactagntggatgggtgacctcctgggaagtccttgtgttgcacctct |
24620760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24621145 - 24621082
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgg----gtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
24621145 |
cttgggcgagagtagtactaggatggatgggtgacctcctgggaagtccttgtgttgcacctct |
24621082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24621468 - 24621405
Alignment:
| Q |
417 |
cttgggcgagagtagtattagg----atgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24621468 |
cttgggcgagagtagtactaggnnggatgggtgacctcctgggaagtccttgtgttgcacctct |
24621405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24625718 - 24625655
Alignment:
| Q |
417 |
cttgggcgagagtagtattagg----atgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24625718 |
cttgggcgagagtagtactaggntggatgggtgacctcctgggaagtccttgtgttgcacctct |
24625655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24626684 - 24626621
Alignment:
| Q |
417 |
cttgggcgagagtagta----ttaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24626684 |
cttgggcgagagtagtactaggtaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24626621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24635628 - 24635565
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgg----gtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
24635628 |
cttgggcgagagtagtactaggatggatgggtgacctcctgggaagtccttgtgttgcacctct |
24635565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24636329 - 24636266
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgg----gtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
24636329 |
cttgggcgagagtagtactaggatggatgggtgacctcctgggaagtccttgtgttgcacctct |
24636266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24636652 - 24636589
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgg----gtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
24636652 |
cttgggcgagagtagtactaggatggatgggtgacctcctgggaagtccttgtgttgcacctct |
24636589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24637577 - 24637514
Alignment:
| Q |
417 |
cttgggcgagagtagta----ttaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24637577 |
cttgggcgagagtagtactaggtaggatgggtgacctcctgggaagtccttgtgttgcacctct |
24637514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24639504 - 24639441
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgg----gtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
24639504 |
cttgggcgagagtagtactaggatggatgggtgacctcctgggaagtccttgtgttgcacctct |
24639441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24639827 - 24639764
Alignment:
| Q |
417 |
cttgggcgagagtagtattagg----atgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24639827 |
cttgggcgagagtagtactaggnnggatgggtgacctcctgggaagtccttgtgttgcacctct |
24639764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24640150 - 24640087
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgg----gtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
24640150 |
cttgggcgagagtagtactaggatggatgggtgacctcctgggaagtccttgtgttgcacctct |
24640087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24635305 - 24635242
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgg----gtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||| | |||||||||||||||||||||||| |
|
|
| T |
24635305 |
cttgggcgagagtagtactaggatggatgggtgacctccngggaagtccttgtgttgcacctct |
24635242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 417 - 476
Target Start/End: Complemental strand, 24636975 - 24636912
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgg----gtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||| | |||||||||||||||||||||||| |
|
|
| T |
24636975 |
cttgggcgagagtagtactaggatggatgggtgacctccagggaagtccttgtgttgcacctct |
24636912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 417 - 482
Target Start/End: Original strand, 32352347 - 32352412
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacc |
482 |
Q |
| |
|
||||| ||| ||| |||||||||||||||||||| | ||||| |||||||||||||||| |||| |
|
|
| T |
32352347 |
cttggacgaaagtggtattaggatgggtgaccttttaaaaagtctttgtgttgcacctctctcacc |
32352412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1024 (Bit Score: 48; Significance: 5e-18; HSPs: 1)
Name: scaffold1024
Description:
Target: scaffold1024; HSP #1
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 417 - 476
Target Start/End: Original strand, 53 - 112
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
53 |
cttgggcgagagtagtactaggatgggtgacctcctgggaagtccgtgtgttgcacctct |
112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 417 - 476
Target Start/End: Original strand, 14903158 - 14903217
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctct |
476 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
14903158 |
cttgggcgagagtagtactaggatgggtgacctcctgaaaagtccttgtgttgcacctct |
14903217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 417 - 468
Target Start/End: Original strand, 16990093 - 16990144
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgtt |
468 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||||||||||||||||| |
|
|
| T |
16990093 |
cttgggcgagagtagtactaggatgagtgacctattgggaagtccttgtgtt |
16990144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 423 - 472
Target Start/End: Complemental strand, 30729467 - 30729418
Alignment:
| Q |
423 |
cgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcac |
472 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
30729467 |
cgagagtagcattaggatgggtgaccttctgaaaagtcattgtgttgcac |
30729418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 418 - 472
Target Start/End: Original strand, 2557895 - 2557949
Alignment:
| Q |
418 |
ttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcac |
472 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2557895 |
ttggccgagagtagtactaggatgggtgacctcctgggaagtccttgtgttgcac |
2557949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 439 - 474
Target Start/End: Complemental strand, 12891645 - 12891610
Alignment:
| Q |
439 |
atgggtgaccttctgggaagtccttgtgttgcacct |
474 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
12891645 |
atgggtgaccttctgggaagtccttgtgttgcacct |
12891610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000004; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 435 - 487
Target Start/End: Complemental strand, 42435349 - 42435297
Alignment:
| Q |
435 |
taggatgggtgaccttctgggaagtccttgtgttgcacctctcccaccctttt |
487 |
Q |
| |
|
||||||| ||||| || |||||| |||||||||||||||||||||||| |||| |
|
|
| T |
42435349 |
taggatgagtgacgttatgggaaatccttgtgttgcacctctcccaccatttt |
42435297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 432 - 475
Target Start/End: Complemental strand, 19426053 - 19426010
Alignment:
| Q |
432 |
tattaggatgggtgaccttctgggaagtccttgtgttgcacctc |
475 |
Q |
| |
|
||||||||||||||||||||||| || |||||| |||||||||| |
|
|
| T |
19426053 |
tattaggatgggtgaccttctggaaaatccttgcgttgcacctc |
19426010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.00000002; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 449 - 480
Target Start/End: Complemental strand, 38580369 - 38580338
Alignment:
| Q |
449 |
ttctgggaagtccttgtgttgcacctctccca |
480 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38580369 |
ttctgggaagtccttgtgttgcacctctccca |
38580338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 424 - 488
Target Start/End: Original strand, 13642504 - 13642566
Alignment:
| Q |
424 |
gagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacctctcccacccttttt |
488 |
Q |
| |
|
|||||||||| || |||||||||||| |||||| ||||||||||||| ||| ||||||||||| |
|
|
| T |
13642504 |
gagagtagtactaagatgggtgacctcatgggaaatccttgtgttgca--tcttccacccttttt |
13642566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 417 - 474
Target Start/End: Complemental strand, 24724728 - 24724671
Alignment:
| Q |
417 |
cttgggcgagagtagtattaggatgggtgaccttctgggaagtccttgtgttgcacct |
474 |
Q |
| |
|
|||||||||||||| |||||| | |||| |||| ||| ||||||||||||||||||| |
|
|
| T |
24724728 |
cttgggcgagagtaatattagaacgggtaacctcgtggaaagtccttgtgttgcacct |
24724671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University