View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8911_low_54 (Length: 467)
Name: NF8911_low_54
Description: NF8911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8911_low_54 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 233
Target Start/End: Original strand, 7150482 - 7150694
Alignment:
| Q |
19 |
tgttctcgcaggcgccaccaccttttggtggaggatggcttgcataaatctctaatatgctccatgtttcgttgcttgatggttttaggtcctaggcctg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
7150482 |
tgttctcgcaggcgccaccaccttttggtggaggatggcttgcataaatctctaatttgctccatgtttcgttgcttgatggttttaggtcctaggcatg |
7150581 |
T |
|
| Q |
119 |
tacttgaattcaaaggtttaattgaggtattatgatttgatgctttggcttaggttgtgaatgttgtttccgtggtgatctttttgtgggtgttttggtt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7150582 |
tacttgaattcaaaggtttaattgaggtattatgatttgatgctttggcttaggttgtgga--ttgtttccgtggtgatctttttgtgggtgttttggtt |
7150679 |
T |
|
| Q |
219 |
gtctgcactgaagag |
233 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7150680 |
gtctgcactgaagag |
7150694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 111; E-Value: 8e-56
Query Start/End: Original strand, 323 - 453
Target Start/End: Original strand, 7150787 - 7150917
Alignment:
| Q |
323 |
tttgtttgttcctctgcttagttttgtgtccgcatgggagagtgacacatatttacgactctttatcagatttgggtttgaactcggatctataactttt |
422 |
Q |
| |
|
|||||||||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7150787 |
tttgtttgtttctctgcttggttttgtatccgcatgggagagtgacacatatttacgactctttatcagatttgggtttgaactcagatctataactttt |
7150886 |
T |
|
| Q |
423 |
taggttttagtttggttttggttatgatgtc |
453 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |
|
|
| T |
7150887 |
taggttttaatttggttttggttatgatgtc |
7150917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University