View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8911_low_88 (Length: 335)
Name: NF8911_low_88
Description: NF8911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8911_low_88 |
 | |
|
| [»] scaffold0076 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 1e-78; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 167 - 319
Target Start/End: Original strand, 21280162 - 21280314
Alignment:
| Q |
167 |
ctaatctgcaactacagaaacaaacaatacacaaatatatggtaatgttgttaatgttattgtatttactttattcaagccattgcaccattcatctttt |
266 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21280162 |
ctaatctgcaactacataaacaaacaatacacaaatatatggtaatgttgttaatgttattgtatttactttattcaagccattgcaccattcatctttt |
21280261 |
T |
|
| Q |
267 |
tcagttgcgagataatatatggttactttatgtgtttaatttcagcacattac |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21280262 |
tcagttgcgagataatatatggttactttatgtgtttaatttcagcacattac |
21280314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 8 - 115
Target Start/End: Original strand, 21279797 - 21279904
Alignment:
| Q |
8 |
agccattggaaaaagaatccaatgttgcaaatgaaatataaattctaatgtaaagaaagatgagaatgatgaagatgctttttaagatatgcatgaaact |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21279797 |
agccattggaaaaagaatccaatgttgcaaatgaaacataaattctaatgtaaagaaagatgagaatgatgaagatgctttttaagatatacatgaaact |
21279896 |
T |
|
| Q |
108 |
gtgtcacg |
115 |
Q |
| |
|
|||||||| |
|
|
| T |
21279897 |
gtgtcacg |
21279904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 273
Target Start/End: Original strand, 21150406 - 21150455
Alignment:
| Q |
225 |
attgtatttactttattcaagccattgcaccattcatc-tttttcagttg |
273 |
Q |
| |
|
|||| ||| |||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
21150406 |
attggattcactttaatcaagccattgcaccattcatcatttttcagttg |
21150455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 236 - 292
Target Start/End: Original strand, 33706491 - 33706548
Alignment:
| Q |
236 |
tttattcaagccattgcaccattcat-ctttttcagttgcgagataatatatggttac |
292 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||| ||||| ||||| ||||| |
|
|
| T |
33706491 |
tttaatcaagccattgcaccattcatcctttttcagttgtgagatgttatatagttac |
33706548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0076 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0076
Description:
Target: scaffold0076; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 45 - 114
Target Start/End: Original strand, 15643 - 15713
Alignment:
| Q |
45 |
ataaattctaatgtaaagaaagatgagaatgatgaagatgct-ttttaagatatgcatgaaactgtgtcac |
114 |
Q |
| |
|
||||||| |||||| ||| |||||| ||||||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
15643 |
ataaattataatgttaaggaagatgttaatgatgaagatgctctttttagatacacatgaaactgtgtcac |
15713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University