View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_105 (Length: 324)
Name: NF8912A_low_105
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_105 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 7 - 324
Target Start/End: Original strand, 52423384 - 52423701
Alignment:
| Q |
7 |
tggtgttgcacagccttttgggtatctggactgcatgggggtggctatagtttgcatttctgggagtcacgcagtttctgcgttgcagtcatcgttatgg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
52423384 |
tggtgttgcacagccttttgggtatctggactgcatggtggtggctatagtttgcatttctgggagtcacgcagtttgtgcgttgcagtcatcgttgtgg |
52423483 |
T |
|
| Q |
107 |
agtttatttttcaggtcagtggctttttgctctgttgatgcctcatttcctggaccttgtactgttagttttagtcttaggactctgtgtggtgtgtttt |
206 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
52423484 |
agtttatttttcaggtgagtggctttttgctctgttgatgcctcatttcgtggaccttgtactgttagttttagtcttaggactctgtgtggtgtgtctt |
52423583 |
T |
|
| Q |
207 |
tgctaattatgtggcgtattgtgtaggagaggcagttgatgaatggtattcttcctcttctgctgtcagtagctgtgtcttaaggtggatgcggtctctc |
306 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
52423584 |
tgctaattatgtggcgtattgtgaaggagaggcagttggtgaatggtattcttcctcttctgttgtcagtagctttgtcttaaggtggatgcggtttctt |
52423683 |
T |
|
| Q |
307 |
tgcctatttgtgttttag |
324 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
52423684 |
tgactatttgtgttttag |
52423701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University