View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_121 (Length: 303)
Name: NF8912A_low_121
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_121 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 9 - 303
Target Start/End: Complemental strand, 31943218 - 31942923
Alignment:
| Q |
9 |
agcatagactccatggatgatggcagaggtccacccaaaaggattagaggaaatcaccaatctcctaatacattggcaagttcttctaatgggattgcta |
108 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
31943218 |
agcatagactccatggattctggtagaggtccacccaaaaggattagaggaaatcaccaatctcctagtacattggcaagttcttttaatgggattgcta |
31943119 |
T |
|
| Q |
109 |
tgagggataatgcaacattgttatctcaaattcatttgctggatcaagtaggacaacttggtaattcatggagcaggttcagtcaatcaattatggtgaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||| | ||||||||||||||||||| |
|
|
| T |
31943118 |
tgagggataatgcaacattgttatctcaaattcacttgctcgatcaagtaggacaacttggtaattcatggagaaggcccggtcaatcaattatggtgaa |
31943019 |
T |
|
| Q |
209 |
taacggtaataaccatttagttcctgaaaataatttggtgcaacacttttggccaacgcctcatatacaaggtaaagtttaatttt-ttattttga |
303 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| ||||||||| |
|
|
| T |
31943018 |
taacggtaatagccatttagttcctgaaaacaatttggtgcaacacttttggccaacgcctcatatacaaggtaaaattttattttcttattttga |
31942923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 9 - 283
Target Start/End: Complemental strand, 31952411 - 31952125
Alignment:
| Q |
9 |
agcatagactccatggatgatggcagaggtccacccaaaaggattagaggaaatcaccaatctcctaatacattggcaagttctt------------cta |
96 |
Q |
| |
|
|||||| |||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
31952411 |
agcatatactcaatggatgatggtagaggtccacccaaaagaattagaggaaatcaccaatctcctaatacattggcaagttcttctatttctcccccta |
31952312 |
T |
|
| Q |
97 |
atgggattgctatgagggataatgcaacattgttatctcaaattcatttgctggatcaagtaggacaacttggtaattcatggagcaggttcagtcaatc |
196 |
Q |
| |
|
| | | |||||||| ||| ||||| ||||||| |||||||||||||||||| ||||||||| ||||||||||||||||||||| || ||| || |
|
|
| T |
31952311 |
acgaggttgctatggggggtaatgtaacattgccatctcaaattcatttgctcaatcaagtagaacaacttggtaattcatggagtagaccaggtcggtc |
31952212 |
T |
|
| Q |
197 |
aattatggtgaataacggtaataaccatttagttcctgaaaataatttggtgcaacacttttggccaacgcctcatatacaaggtaa |
283 |
Q |
| |
|
||||||||||||| | ||||| |||||| |||||||||| |||||||||||||||||| ||||| | ||||||||||||||| |
|
|
| T |
31952211 |
tcttatggtgaataatgaaaataatcatttaattcctgaaaacaatttggtgcaacactttcaaccaacacttcatatacaaggtaa |
31952125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University