View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_147 (Length: 287)
Name: NF8912A_low_147
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_147 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 5 - 287
Target Start/End: Original strand, 17687513 - 17687795
Alignment:
| Q |
5 |
agattatactagtagggactatattggaagagcgtgatgctcgcctagtatttgtagtttatacgaagactgcaagttctaggagtaacgaggattggtg |
104 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17687513 |
agattatactagtagggactatgttggaagagcgtgatgctcgcctagtatttgtagtttatacgaagactgcaagttctaggagtaacgaggattggtg |
17687612 |
T |
 |
| Q |
105 |
gtttgcaaagaacctttctcatataaatatttgcataaacctagcgatttcaatgttttgccttgtaatgtgctcgtaaagagctggttaatttgagaag |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17687613 |
gtttgcaaagaacctttctcatataaatatttgcataaaccaagcgatttcaatgttttgtcttgtaatgtgctcgtaaagagctggttaatttgagaag |
17687712 |
T |
 |
| Q |
205 |
aattgtgcacgcaaatagtgaaggataacgatgcctatttgtttgtggttactacctggatcctctagatttgattttgatga |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17687713 |
aattgtgcacgcaaatagtgaaggataacgatgcccatttgtttgtggttactacctggatcctctaggtttgattttgatga |
17687795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University