View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_185 (Length: 266)
Name: NF8912A_low_185
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_185 |
 | |
|
| [»] scaffold0191 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 6 - 251
Target Start/End: Original strand, 37571506 - 37571751
Alignment:
| Q |
6 |
agttagagcatgttagaaagtaattgcaacttgatatattcaattgttatgtgaatgataagagctcctctgtggttaaatttaataatttacggagttt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37571506 |
agttagagcatgttagaaagtaattgcaacttgatatattcaattgttatgtgaatgataagagctcctctgtggttaaatttaataatttacggagttt |
37571605 |
T |
|
| Q |
106 |
agtacttggagggcactttggtgtattatgttttacttaaacaatgctcttttgcctagtcttaattggcgtagttttaaattcaattgcacatctctct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37571606 |
agtacttggagggcactttggtgtattatgttttacttaaacaatgctcttttgcctagtcttaattggcgtagttttaaattcaattgcacatctctct |
37571705 |
T |
|
| Q |
206 |
aggtgggtcttgaatcattacaaatggattatatggaaactggcat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37571706 |
aggtgggtcttgaatcattacaaatggattgtatggaaactggcat |
37571751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 199 - 251
Target Start/End: Original strand, 10433552 - 10433604
Alignment:
| Q |
199 |
tctctctaggtgggtcttgaatcattacaaatggattatatggaaactggcat |
251 |
Q |
| |
|
||||| ||||||||| |||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
10433552 |
tctctttaggtgggtattgaatcattacaagtggattgtatggaaactggcat |
10433604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0191 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0191
Description:
Target: scaffold0191; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 205 - 251
Target Start/End: Complemental strand, 28693 - 28647
Alignment:
| Q |
205 |
taggtgggtcttgaatcattacaaatggattatatggaaactggcat |
251 |
Q |
| |
|
||||||||| |||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
28693 |
taggtgggtattgaatcattacaagtggattgtatggaaactggcat |
28647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University