View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_186 (Length: 265)
Name: NF8912A_low_186
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_186 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 7 - 250
Target Start/End: Complemental strand, 2099490 - 2099248
Alignment:
| Q |
7 |
ggagaaaccactattctattgtttgcttttggttaagctatttgacatttggttctaagaattacgtatttggttcgtagactttgtgaaaagaaagagn |
106 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
2099490 |
ggagaaaccactattctattgtttgcatttggttaagctatttgacatttggttctaagaattacgtatttggttcgtagactgtgtgaaaagaaata-a |
2099392 |
T |
|
| Q |
107 |
nnnnnnnncgactttcctttgcaattgggtttgtctatttggtactattttgtgggtacaatttagtcgatagtttatcttgctttgtgttgtttggtca |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2099391 |
aaaaaaaacgactttcctttgcaattgggtttgtctatttggtactattttgtgggtacaatttagtcgatagtttatcttgctttgcattgtttggtca |
2099292 |
T |
|
| Q |
207 |
ttggtccttgattgattgtctctttctacattggtctcttctat |
250 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2099291 |
ttggtccttgattgattgtgtctttctacattggtctcttctat |
2099248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University