View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_192 (Length: 263)
Name: NF8912A_low_192
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_192 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 236
Target Start/End: Original strand, 32103473 - 32103698
Alignment:
| Q |
11 |
aatatatagtgagtgaggaagaggaaaggaaaatgatgacgtacagttgttgtgggcaaagttgccagaagaggctataagtccactgaacagattgcac |
110 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32103473 |
aatatatagtgagtgaggaagaggaaaagaaaatgatgacgtacagttgttgtgggcaaagttgccagaagaggctataagtccactgaacagattgcac |
32103572 |
T |
|
| Q |
111 |
cgcagcctgcaacatgttctgaagcttactgcctaatggagatggagccgccattctttattcattcagtcattaccaaacagttttttctttcatttct |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32103573 |
cgcagcctgcaacatgttttgaagcttactgcctaatggagatggagcagccattctttattcattcagtcattaccaaacagttttttctttcatttct |
32103672 |
T |
|
| Q |
211 |
ctgcaatatttaatcatatctaaaac |
236 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
32103673 |
ctgcaatatttaatcatatctaaaac |
32103698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University