View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_199 (Length: 261)
Name: NF8912A_low_199
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_199 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 10599655 - 10599419
Alignment:
| Q |
1 |
gtcgagtttggttttggatttgtgtgttaggtgtagtttggttgatatgtatgcgaaatgtggattggtgcgagaggctaggaaagtgtttgatggtatg |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10599655 |
gtcgggtttggttttggatttgtgtgttgggtgtagtttggttgatatgtatgcgaaatgtggattggtgcaagaggctaggaaagtgtttgatggtatg |
10599556 |
T |
|
| Q |
101 |
agagagcataatgtgatgtcgtggacggcacttattaatggatatgtaagaggcggtggtggatatgaacgggaagctatgagattgtttagcgatatgt |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
10599555 |
agggagcataatgtgatgtcgtggacggctcttgttaatggatatgtacgaggcggtggtggatatgaacgggaagctatgagaatgtttagtaatatgt |
10599456 |
T |
|
| Q |
201 |
tgcttcagggttgtgttgcgccaaattgctttacgtt |
237 |
Q |
| |
|
||||||||||| |||||||||| || ||||||||||| |
|
|
| T |
10599455 |
tgcttcagggtggtgttgcgccgaactgctttacgtt |
10599419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University