View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_229 (Length: 250)
Name: NF8912A_low_229
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_229 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 16 - 237
Target Start/End: Complemental strand, 13795323 - 13795102
Alignment:
| Q |
16 |
aaatgtaattacattcaaccattttcttaattattaatgttgtttacatgtcagcattaatgtcgtcctcagtattcgaatttgtgtcagcgttaatatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13795323 |
aaatgtaattacattcaaccattttcttaattattaatgttgtttacatgtcagcattaatgtcgtcctcagtattcgaatttgtgtcagcgttaatatc |
13795224 |
T |
|
| Q |
116 |
gtccttatttgttatacatttacctgcaggctttcatggatggatggcaagcagcctgcaagtccaaagtgcaagccaggcttctaatcccttcaggaag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13795223 |
gtccttatttgttatacatttacctgcaggctttcatggatggatggcaagcagcctgcaagtccaaagtgcaagccaggcttctaatcccttcaggaag |
13795124 |
T |
|
| Q |
216 |
attccttgtttcttcaatgttc |
237 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
13795123 |
attccttgtttcttcaatgttc |
13795102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University