View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_260 (Length: 246)
Name: NF8912A_low_260
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_260 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 4 - 246
Target Start/End: Original strand, 25616698 - 25616940
Alignment:
| Q |
4 |
cgcgggctggtacagttcggaatcaaagcagttcagattgggagaggcctaattatggcttgctcaaatgtaatgtggatgcggcatttaacgaaagagc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |||||||| ||||||||| |||||| |
|
|
| T |
25616698 |
cgcgggctggtacagttcggaatcaaagcagttcagattaggagaggcctaattatggcttgctcaaacgtaacgtggatgcagcatttaaccgaagagc |
25616797 |
T |
 |
| Q |
104 |
cggtattacatccattgagtgctgtgtacgaaataacaatggagaatttgtgatgtcacaaacaagttggaaacaagcgaacttatcaatcctcgaaggc |
203 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
25616798 |
tggtattacattcattgggtgctgtgtacgaaataacaatgaagaatttgtgatgttacaaacaagttggaaacaagcgaacttatcaatcctcgaatgc |
25616897 |
T |
 |
| Q |
204 |
gaagctacttcactattagaaggactgaatatggctattgtta |
246 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25616898 |
gaagctacttcactattagaaggactgcatatggctattgtta |
25616940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University