View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_267 (Length: 245)
Name: NF8912A_low_267
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_267 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 34824436 - 34824669
Alignment:
| Q |
1 |
ttatatatggctgagttggaacgggttttatttgccgtttataaatgtcgagccttgttactaaatcatcaaaattgtagtctgtatgactggatttatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34824436 |
ttatatatggctgagttggaacgggttttatttgccgtttataaatgtcgagccttgttactaaatcatcaaaattgtagtctgtatgactggatttatc |
34824535 |
T |
|
| Q |
101 |
acaagaaaaatgatgtaaaccttgttgctcatactctctaactatagcgtgaaggtcttatgttagcacaaagcacgcaagtattgtaaggcacgatgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| | || | |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34824536 |
acaagaaaaatgatgtaaaccttgttgctcatactctctaaccatagc----acatccaa---aagcacaaagcacgcaagtattggaaggcacgatgta |
34824628 |
T |
|
| Q |
201 |
tttattcatctatgataactaaacaagtgatgtccatctca |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34824629 |
tttattcatctatgataactaaacaagtaatgtccatctca |
34824669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University