View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8912A_low_268 (Length: 245)

Name: NF8912A_low_268
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8912A_low_268
NF8912A_low_268
[»] chr5 (2 HSPs)
chr5 (12-120)||(29783974-29784082)
chr5 (191-235)||(29783859-29783903)


Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 12 - 120
Target Start/End: Complemental strand, 29784082 - 29783974
Alignment:
12 tggacatcaatcttcttgaaactggatgtcttggttttgcaattattgttacagccttcactttacaggtctgcacaattccttcatagttcatacattc 111  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
29784082 tggacttcaatcttcttgaaactggatgtcttggttttgcaattattgttacagccttcactttacaggtctgcacaatgccttcatagttcatacattc 29783983  T
112 cactttctc 120  Q
    |||||||||    
29783982 cactttctc 29783974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 191 - 235
Target Start/End: Complemental strand, 29783903 - 29783859
Alignment:
191 ggatggaacttcacactatttgaaaggagtgattcttactctatg 235  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
29783903 ggatggaacttcacactatttgaaaggagtgattcttactctatg 29783859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University