View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_268 (Length: 245)
Name: NF8912A_low_268
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_268 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 12 - 120
Target Start/End: Complemental strand, 29784082 - 29783974
Alignment:
| Q |
12 |
tggacatcaatcttcttgaaactggatgtcttggttttgcaattattgttacagccttcactttacaggtctgcacaattccttcatagttcatacattc |
111 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29784082 |
tggacttcaatcttcttgaaactggatgtcttggttttgcaattattgttacagccttcactttacaggtctgcacaatgccttcatagttcatacattc |
29783983 |
T |
|
| Q |
112 |
cactttctc |
120 |
Q |
| |
|
||||||||| |
|
|
| T |
29783982 |
cactttctc |
29783974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 191 - 235
Target Start/End: Complemental strand, 29783903 - 29783859
Alignment:
| Q |
191 |
ggatggaacttcacactatttgaaaggagtgattcttactctatg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29783903 |
ggatggaacttcacactatttgaaaggagtgattcttactctatg |
29783859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University