View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_290 (Length: 239)
Name: NF8912A_low_290
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_290 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 13 - 239
Target Start/End: Original strand, 41404157 - 41404383
Alignment:
| Q |
13 |
aatatcacatttacgttgaagctataaatagtagattctggttttggcagtcaaaagaccttcaatcgtgtggctgcaatgaaatgatgtgtatgaaagt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41404157 |
aatatcacatttacgttgaagctataaatagtagattctggtattcgcagtcaaaagaccttcaatcgtgtggctgcaatgaaatgatgtgtatgaaagt |
41404256 |
T |
|
| Q |
113 |
aggaatcagaccctataagacatgtttgatagattacgagtcaattagagtcatttttggcatgtgctctactcgcaagcaattgtgttccttgacttcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41404257 |
aggaatcagaccctataagacatgtttgatagattacgagtcaattagagtcatttttggcatgtgctctactcgcaagcaattgtgttccttgacttcc |
41404356 |
T |
|
| Q |
213 |
ttctaagtcgattgaacagaaaccata |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
41404357 |
ttctaagtcgattgaacagaaaccata |
41404383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University