View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_293 (Length: 239)
Name: NF8912A_low_293
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_293 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 6 - 219
Target Start/End: Complemental strand, 1330438 - 1330225
Alignment:
| Q |
6 |
tttggtgttactcagggtgaattaactcgttatctagatgcccttctgaaagatagtgaacacttagccgccatgattgatactgtatcttctgttgata |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
1330438 |
tttggtgttactcagggtgaattaactcgttatctagatgcccttctgaaagatagtgaacacttagcagccatgattgataatgtatcttctgttgata |
1330339 |
T |
|
| Q |
106 |
acttggattttatcatggaaagtgatgctctaagccataaagttatggaccagagacaagggcatgaaagtttgcttgctgttgctgggacagttaccct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1330338 |
acttggattttatcatggaaagtgatgctctaagccataaagttatggaccagagacaagggcatgaaagtttgcttgctgttgctgggacagttaccct |
1330239 |
T |
|
| Q |
206 |
tgacgaggtatttt |
219 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1330238 |
tgacgaggtatttt |
1330225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University