View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_295 (Length: 239)
Name: NF8912A_low_295
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_295 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 222
Target Start/End: Original strand, 12684745 - 12684951
Alignment:
| Q |
16 |
gatgaacaaggctatgaaggttcatggtatcctgcaactgttgttgatttatatcaaaatggaaagtacttggtggagtattcaaccttgaaaacagatg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12684745 |
gatgaacaaggctatgaaggttcatggtatcctgcaactgttgttgatttatatcaaaatggaaagtacttggtggagtattcaaccttgaaaacagatg |
12684844 |
T |
 |
| Q |
116 |
acttaattcaacagctgaaagaagtggtggatgtttcggatatcagaccgcgtccaccagctctcgatcatttttgtcgatatgtgaggcaggattgggt |
215 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12684845 |
acttaactcaacagctgaaagaagtggtagatgtttcggatatcagaccgcgtccaccagatatcgatcatttttgtcgatatgtgaggcaggaatgggt |
12684944 |
T |
 |
| Q |
216 |
tgatgct |
222 |
Q |
| |
|
||||||| |
|
|
| T |
12684945 |
tgatgct |
12684951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University