View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_310 (Length: 235)
Name: NF8912A_low_310
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_310 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 14 - 235
Target Start/End: Original strand, 1123794 - 1124015
Alignment:
| Q |
14 |
atggacatcatgaggccatttgcagaatctgttttgagtgggtgagtcatttgnnnnnnnnnnnnnncttnnnnnnncaaattattagtatcttcttcat |
113 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
1123794 |
atggacataatgaagccatttgcagaatctgttttgagtgggtgagtcatttgttttttctttttttcttaaaaaaacaaattattagtatcttcttcat |
1123893 |
T |
|
| Q |
114 |
tgcttgtttcacctatggctgacatgaggtggacttcccaggtttattaatagaggaccatcagtaaatgatagatgggtttttgattccccagtccatt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1123894 |
tgcttgtttcacctatggctgacatgaggttgacttcccaggtttattaatagaggaccatcagtaaatgatagatgggtttttgattccccagtccatt |
1123993 |
T |
|
| Q |
214 |
ctaacgttgaagctaagctgag |
235 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1123994 |
ctaacgttgaagctaagctgag |
1124015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University