View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_325 (Length: 230)
Name: NF8912A_low_325
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_325 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 15112964 - 15112857
Alignment:
| Q |
1 |
tatagtaaaccttagcttgagtcgttgtaatcgtactgaaatgctattgtttatcttattactaatagttattattagatgaacgaagtaactacactat |
100 |
Q |
| |
|
||||||||| |||||||||||| |||||||| |||||||||||||| |||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
15112964 |
tatagtaaaagttagcttgagtcattgtaatcatactgaaatgctatcgtttatcttattactactatttattattagatgaacgaagtaactacactat |
15112865 |
T |
 |
| Q |
101 |
tctcatat |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
15112864 |
tctcatat |
15112857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University