View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_330 (Length: 230)
Name: NF8912A_low_330
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_330 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 47 - 230
Target Start/End: Original strand, 10313562 - 10313745
Alignment:
| Q |
47 |
cccaattcagtgcccatagcaaacccgaagctattgtgatatgtacttcacaacttggtgcaaaccattcagtgttggccaaaacaaaaacacctcagtc |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10313562 |
cccaattcagtgcccatagcaaacccgaagctactgtgatatgtacttcacaacttggtgaaaaccattcagtgttggccaaaacaaaaacacctcagtc |
10313661 |
T |
|
| Q |
147 |
atctcggctatacacacccaacttaatgtggaatactcaaaggagttgaaacggcgcatggcaatatacagacattggatgtga |
230 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||||||| ||||||| | |||||||| ||||||||||||| |
|
|
| T |
10313662 |
atctcggctatacacacctagcttaatgtggaatactcaaaggagttgaaatggcgcattgtaatatacacacattggatgtga |
10313745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 10313488 - 10313532
Alignment:
| Q |
1 |
agcaatgaattccacaacatccctctatgaagaggctgtgctatc |
45 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10313488 |
agcaatgaattccacaacatcactctatgaagaggctgtgctatc |
10313532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University