View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_343 (Length: 230)
Name: NF8912A_low_343
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_343 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 96 - 230
Target Start/End: Complemental strand, 30335881 - 30335747
Alignment:
| Q |
96 |
gtgttgcgtacaaaaaccaacttccttatgaaaccagctatatagctcaacatctcacctgcacataatgtacaccagttatctttgtgggtgtactaac |
195 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30335881 |
gtgttgcgtacaaaagccaacttccttatgaaaccagctatatagctcaacatctcacctgcacataatgtacaccagttatctttgtgggtgtactaac |
30335782 |
T |
|
| Q |
196 |
taattcaattacagagtttccatttatttttctga |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
30335781 |
taattcaattacagagtttccatttatttttctga |
30335747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 30335976 - 30335934
Alignment:
| Q |
1 |
aaaataagttcttggtgcaagtagaaccaattgcttaggaagt |
43 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30335976 |
aaaagaagttcttggtgcaagtagaaccaattgcttaggaagt |
30335934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University