View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_365 (Length: 227)
Name: NF8912A_low_365
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_365 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 7309971 - 7309764
Alignment:
| Q |
1 |
tttgaatttcgctctattgttgaaattggttcattttgaattgtagatctacaacctgagcttcaaacacatcaagcgacaagcatgaatgatggaacat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7309971 |
tttgaatttcgctctattgttgaaattggttcattttgaattgtagatctacaacctgagcttcaaacacatcaagc-------atgaatgatggaacat |
7309879 |
T |
|
| Q |
101 |
ggcggcagaatgttatgaagaaaaatattgcagcttattggaacttgtttgtttattgtactaattttacagagcctattttcacccgagctaaaactcc |
200 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7309878 |
ggcggcagaatgctatgaagcaaaatattgcagctttttggaacttgtttgtttattgtactaattttatagagcctattttcacccgagctaaaactcc |
7309779 |
T |
|
| Q |
201 |
attgctatttatgag |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7309778 |
attgctatttatgag |
7309764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 87 - 201
Target Start/End: Original strand, 7330063 - 7330181
Alignment:
| Q |
87 |
gaatgatggaacatggcggcagaatgttatgaagaaaaatattgcagcttattgg------aacttgtttgtttattgtactaattttacagagcctatt |
180 |
Q |
| |
|
|||||||||| |||||| || ||||| ||||||||||||||||| |||||||||| |||||||||| |||||||||| ||||| | || ||||| |
|
|
| T |
7330063 |
gaatgatggagcatggctgcggaatgctatgaagaaaaatattggagcttattggaactacaacttgtttggttattgtactcatttt--atagtctatt |
7330160 |
T |
|
| Q |
181 |
ttcacccgagctaaaactcca |
201 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7330161 |
ttcacccgagctaaaactcca |
7330181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 15 - 59
Target Start/End: Original strand, 7330012 - 7330056
Alignment:
| Q |
15 |
tattgttgaaattggttcattttgaattgtagatctacaacctga |
59 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7330012 |
tattgtttaaatgggttcattttgaattgtagatctacaacctga |
7330056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University