View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_368 (Length: 226)
Name: NF8912A_low_368
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_368 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 23 - 214
Target Start/End: Original strand, 40225396 - 40225587
Alignment:
| Q |
23 |
agctatagcaccaaatatataagtggaggaaaaaattacttacaaaaattgaccaagaacgtgggcgtaacgtaaggtttgcgtttaatgagagaatgat |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40225396 |
agctatagcaccaaatatataagtggaggaaaaaattacttacaaaaattgaccaagaacgtgggcgtaacgtaaggtttgagtttaatgagagaatgat |
40225495 |
T |
|
| Q |
123 |
ggtgaaaagacaaagctatttcttaaccaagcttcaatgaatttttgtaatggaagaagggaacagagatgaaaggataagggtatattgtt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40225496 |
ggtgaaaagacaaagctatttcttaaccaagcttcaatgaatttttgtaatggaagaagggaacagagatgaaaggataagggtatagtgtt |
40225587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University