View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_369 (Length: 226)
Name: NF8912A_low_369
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_369 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 32 - 208
Target Start/End: Complemental strand, 40615420 - 40615248
Alignment:
| Q |
32 |
ttgacaaaacatcttgatatgataaattgcgggtaattttagttcaaattaatgttatctttagttagcactttcagatcggtccctaaagttgaaaccc |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40615420 |
ttgacaaaacatcttgatatgataaattgcgggtaattttagttcaaat----gttatctttagttagcactttcagattggtccctaaagttgaaaccc |
40615325 |
T |
|
| Q |
132 |
taaaatcagatggatccgtaaaataaataaatacccaaacaactcagtctctgaaatgtagagcaacatcaagttag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40615324 |
taaaatcagatggatccgtaaaataaataaatacccaaacaattcagtctctgaaatgtagagcaacatcaagttag |
40615248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 40612914 - 40612859
Alignment:
| Q |
155 |
taaataaatacccaaacaactcagtctctgaaatg--tagagcaacatcaagttag |
208 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40612914 |
taaataaatacccacccaattcagtctctgaaatgtatagagcaacatcaagttag |
40612859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University