View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_374 (Length: 224)
Name: NF8912A_low_374
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_374 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 26 - 220
Target Start/End: Original strand, 10566859 - 10567053
Alignment:
| Q |
26 |
gacatcactacaaatttactttggtccttttgccaagaggatgttactgagggtccagaacaactatataactcagagatagcactatattgactttcaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10566859 |
gacatcactacaaatttactttggtccttttgccaagaggatgttactgagggtccagaacaactatataactcagagatagcactatattgactttcaa |
10566958 |
T |
|
| Q |
126 |
actcaccacggtctggaatagatctaatcgtcttcatgaactctaaataatcagtccccatacatggaacctccgagttgatgtccatctcattg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |||||||| |
|
|
| T |
10566959 |
actcaccacggtctggaatagatctaatcgtcttcatgaactctaaataatcagtccccatacatggaacctccgagttgttttccttctcattg |
10567053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University