View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_376 (Length: 224)
Name: NF8912A_low_376
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_376 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 55112799 - 55113022
Alignment:
| Q |
1 |
aaatgggggctatgactgaaatgcaaggggttctttgttccacaagacccatgcgtattggaccagcctctaacaaaaaccttggcacacagacttcaaa |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55112799 |
aaatgagggctatgactgaaatgcaaggggttctttgttccacaagacccatgcgtattggaccagcctctaacaaaaaccttggcacacagacttcaaa |
55112898 |
T |
|
| Q |
101 |
aggtttgnnnnnnnaatggttgatatacgttggccaacataaagataaacttgagctgttttccttcagatgccagtgtttaacctattgatgaataatg |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55112899 |
aggtttgtttttttaatggttgatatacgttggccaacataaagataaacttgagctgttttccttcagatgccagtgtttaacctattgatgaataatg |
55112998 |
T |
|
| Q |
201 |
atactgtttggatataatgtttga |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
55112999 |
atactgtttggatataatgtttga |
55113022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 7 - 81
Target Start/End: Original strand, 7988816 - 7988890
Alignment:
| Q |
7 |
gggctatgactgaaatgcaaggggttctttgttccacaagacccatgcgtattggaccagcctctaacaaaaacc |
81 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||| | ||||| |||||| |||| ||||||| |
|
|
| T |
7988816 |
gggctatgactgagatgcaaggggttctttgttcaacaagacccatgaggattggtccagccactaataaaaacc |
7988890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University