View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_378 (Length: 223)
Name: NF8912A_low_378
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_378 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 213
Target Start/End: Original strand, 22443397 - 22443590
Alignment:
| Q |
17 |
atcagcaaaagtgtcttcggaagaacttaaaataaaaacattgttagtatcctacaagtatctcaatatagaaaagtatctgtgcgttattgggaagtac |
116 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22443397 |
atcagcaaaagtgtcttcggaa---cttaaaaaaaaaacattgttagtatcctacaagtatctcaatatagaaaagtatctgtgcgttattgggaagtac |
22443493 |
T |
 |
| Q |
117 |
ttgcaaattatcataataataattcgtaaaataaaatatatttgggtacttttgggacgcatatccagggagtgccagtgtcctatattgttcgaca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22443494 |
ttgcaaattatcataataataattcgtaaaataaaatatatttgggtacttttgggacgcatatccagggagtgccagtgtcctatatggttcgaca |
22443590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University