View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_392 (Length: 219)
Name: NF8912A_low_392
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_392 |
 |  |
|
| [»] scaffold0009 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0009 (Bit Score: 170; Significance: 2e-91; HSPs: 3)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 21 - 194
Target Start/End: Original strand, 40010 - 40183
Alignment:
| Q |
21 |
tgaagcagcaaaacaacgcggtgttgaggatctctatctatgcatgttacaagtgatgttgtcacctaccattttcgtgtgtgaaacacttgtggtcctc |
120 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40010 |
tgaagcagcaaaacgacgcggtgttgaggatctctatctatgcatgttacaagtgatgttgtcacctaccattttcgtgtgtgaaacacttgtggtcctc |
40109 |
T |
 |
| Q |
121 |
aaattggatagattaaatgtaccctctatgtctcgcttttcggttgatcttccttcgcttaaaacccttgatct |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40110 |
aaattggatagattaaatgtaccctctatgtctcgcttttcggttgatcttccttcgcttaaaacccttgatct |
40183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 23 - 143
Target Start/End: Original strand, 33391 - 33511
Alignment:
| Q |
23 |
aagcagcaaaacaacgcggtgttgaggatctctatctatgcatgttacaagtgatgttgtcacctaccattttcgtgtgtgaaacacttgtggtcctcaa |
122 |
Q |
| |
|
|||||||||||| ||| || || ||||||||||||||||||||| || |||||| ||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33391 |
aagcagcaaaacgacgtggggtcgaggatctctatctatgcatggtagaagtgaccttgtcgcctaccattttcgtgtgtgaaacacttgtggttctcaa |
33490 |
T |
 |
| Q |
123 |
attggatagattaaatgtacc |
143 |
Q |
| |
|
|||||||||| ||| |||||| |
|
|
| T |
33491 |
attggatagaataattgtacc |
33511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 22 - 114
Target Start/End: Original strand, 21734 - 21826
Alignment:
| Q |
22 |
gaagcagcaaaacaacgcggtgttgaggatctctatctatgcatgttacaagtgatgttgtcacctaccattttcgtgtgtgaaacacttgtg |
114 |
Q |
| |
|
|||| |||||||| ||| || || ||||||||||||||| | ||||| |||||| ||||| |||||||||||||| ||| |||||||||| |
|
|
| T |
21734 |
gaagaagcaaaacgacgtggggtcgaggatctctatctaaacttgttagaagtgaccttgtcgcctaccattttcgtttgtagaacacttgtg |
21826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 85 - 189
Target Start/End: Complemental strand, 19970313 - 19970209
Alignment:
| Q |
85 |
cctaccattttcgtgtgtgaaacacttgtggtcctcaaattggatagattaaatgtaccctctatgtctcgcttttcggttgatcttccttcgcttaaaa |
184 |
Q |
| |
|
|||||||||||| ||||||||||||||||| || |||||| ||| || ||||| | |||||| ||| | ||| ||||||||||||||||| |||| |
|
|
| T |
19970313 |
cctaccattttctgctgtgaaacacttgtggttctgaaattgtttagcatacatgtaacaactatgtttcgttcttctgttgatcttccttcgctcaaaa |
19970214 |
T |
 |
| Q |
185 |
ccctt |
189 |
Q |
| |
|
||||| |
|
|
| T |
19970213 |
ccctt |
19970209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University