View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_395 (Length: 218)
Name: NF8912A_low_395
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_395 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 36774355 - 36774138
Alignment:
| Q |
1 |
gttgcatgcaagtttcatcatccacaacaggcagcttcctttggaggagcttatccagtggctgcgtcccctccctccacaactgttacttcatcaggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36774355 |
gttgcatgcaagtttcatcatccacaacaggcagcttcctttggaggagcttatccagtggctgcgtcccctccctccacaactgttacttcatcaggtt |
36774256 |
T |
|
| Q |
101 |
ttccatatgctggtgggtttcctgcatggtcaatgccgagaatgtcatatttatctggacaggccattcaatcttatgtgcctccttttttgccttcttc |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36774255 |
ttccatatgctggtggttttcctgcatggtcaatgccgagaatgtcatatttatctggacaggccattcaatcttatgtgcctccttttttgccttcttc |
36774156 |
T |
|
| Q |
201 |
acaaggcattatgcctgc |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
36774155 |
acaaggcattatgcctgc |
36774138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University