View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_396 (Length: 217)
Name: NF8912A_low_396
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_396 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 23 - 204
Target Start/End: Original strand, 42138660 - 42138841
Alignment:
| Q |
23 |
taacatagatagataaatgaaatgttaaaaaaccatgttaaacttcaacatacttatttctacaaggtaaagacttaggcagcgaagctagcagcagtga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42138660 |
taacatagatagataaatgaaatgttaaaaaaccatgttaaacttcaacatacttatttctacaaggtaaagacttaggcagcgaagctagcagcagtga |
42138759 |
T |
 |
| Q |
123 |
tgcctttgctctttcaagattagtctgtttgtgagaccttatatgctctggaattctttttgtgcctatcttctgatgtcca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42138760 |
tgcctttgctctttcaagattagtctgtttgtgagaccttatatgctctggaattctttttgtgcctatcttctgaagtcca |
42138841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University