View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_40 (Length: 400)
Name: NF8912A_low_40
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_40 |
 | |
|
| [»] scaffold0082 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0082 (Bit Score: 388; Significance: 0; HSPs: 1)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 388; E-Value: 0
Query Start/End: Original strand, 8 - 399
Target Start/End: Original strand, 51855 - 52246
Alignment:
| Q |
8 |
ttcgtgttccagaatgggcagctaaagccttttatttgcctttcatgacgatgaatgaatagtcttctccctctgatcatgatcatggcttgcttaccgg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51855 |
ttcgtgttccagaatgggcagctaaagccttttatttgcctttcatgacgatgaatgaatagtcttctccctctgatcatgatcatggcttgcttaccgg |
51954 |
T |
|
| Q |
108 |
gacttcacttttcccttggttggatggaagtagcctcgtctcgtggcgccggtatcgaccatcgaacgagcagagtggccatttcattcagcactatctc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
51955 |
gacttcacttttcccttggttggatggaagtagcctcgtctcgtggcgccggtatcgaccatcgcacgagcagagtggccatttcattcagcactatctc |
52054 |
T |
|
| Q |
208 |
aacatacataagcccagcagacgtaggcttctaatgggtgatcgcattccgcaactgtaacggattcaccctaggggttcttccctcttgtcctcggcaa |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52055 |
aacatacataagcccagcagacgtaggcttctaatgggtgatcgcattccgcaactgtaacggattcaccctaggggttcttccctcttgtcctcggcaa |
52154 |
T |
|
| Q |
308 |
ccagcaagtttctccttcatcggacaatctcgtgcctgaggaggactcttacaaatgaaagagccagagtccgccttagaaggccttctttg |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52155 |
ccagcaagtttctccttcatcggacaatctcgtgcctgaggaggactcttacaaatgaaagagccagagtccgccttagaaggccttctttg |
52246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University