View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_401 (Length: 216)
Name: NF8912A_low_401
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_401 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 21 - 196
Target Start/End: Original strand, 46477725 - 46477900
Alignment:
| Q |
21 |
agtattgtttgtttctgggattttgaccaaattcttgttacagctgtgatagtagtggaatttagattattttaatttaattgattgaaaaattactgta |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
46477725 |
agtattgtttgtttctgggattttgaccaaattcttgttacagctgtgatagtagtggaatttagattattttaatttaattgatggaaatattactgta |
46477824 |
T |
|
| Q |
121 |
taatgtggttattgttttatatatttgtcaaataatgtgcgtgctaagcgtgtagtgatgaaggggtattagtaat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46477825 |
taatgtggttattgttttatatatttgtcaaataatgtgcgtgctaagcgtgtagtgatgaaggggtattagtaat |
46477900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University