View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_424 (Length: 205)
Name: NF8912A_low_424
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_424 |
 | |
|
| [»] scaffold0204 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 13 - 184
Target Start/End: Original strand, 37071133 - 37071304
Alignment:
| Q |
13 |
agatggacatcacgttgggatgcttatttgaagatggagggttctcgagttcattggttctcaatcctaaattcactgatggttgttattttccttgctg |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37071133 |
agatggccatcacgttgggatgcttatttgaagatggagggttctcgagttcattggttctcaatcctaaattcactgatggttattattttccttgctg |
37071232 |
T |
|
| Q |
113 |
gcattgtttttgtcattttcttaagaactgtaagaagggatttgacaaggtatgaggaattggacaaagagg |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37071233 |
gcattgtttttgtcattttcttaagaactgtaagaagggatttgacaaggtatgaggaattggacaaagagg |
37071304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 25 - 183
Target Start/End: Complemental strand, 43219625 - 43219467
Alignment:
| Q |
25 |
cgttgggatgcttatttgaagatggagggttctcgagttcattggttctcaatcctaaattcactgatggttgttattttccttgctggcattgtttttg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || || ||||||||||| || ||||||||||||||||| | |||| || ||||| |||||||||| |
|
|
| T |
43219625 |
cgttgggatgcttatttgaagatggagggttcccgggtgcattggttctcgattctaaattcactgatggtgatcttttttctagctggtattgtttttg |
43219526 |
T |
|
| Q |
125 |
tcattttcttaagaactgtaagaagggatttgacaaggtatgaggaattggacaaagag |
183 |
Q |
| |
|
|||||||||||||||| || |||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
43219525 |
tcattttcttaagaacagtgagaagggacttggcaaggtatgaggaattggacaaagag |
43219467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 28 - 153
Target Start/End: Original strand, 222 - 347
Alignment:
| Q |
28 |
tgggatgcttatttgaagatggagggttctcgagttcattggttctcaatcctaaattcactgatggttgttattttccttgctggcattgtttttgtca |
127 |
Q |
| |
|
||||||||||| |||||||||||||| | ||| ||||||||||| ||||| ||||| ||||||| | | |||||||||||| |||||| |||| | |
|
|
| T |
222 |
tgggatgcttacttgaagatggagggagccaaagtccattggttctcgatcctcaattcgttgatggtgatcactttccttgctggtattgttcttgtta |
321 |
T |
|
| Q |
128 |
ttttcttaagaactgtaagaagggat |
153 |
Q |
| |
|
| ||||| |||||||| || |||||| |
|
|
| T |
322 |
tcttcttgagaactgttaggagggat |
347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University