View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_426 (Length: 204)
Name: NF8912A_low_426
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_426 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 7741406 - 7741488
Alignment:
| Q |
19 |
tcttttaattaatatccaatcgatcgataaagtattatttgcaaatctcttccaacttgtttgctacaggtttgttttactat |
101 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7741406 |
tcttttaattaatatccaatcaatcgataaagtattatttgcaaatctcttccatcttgtttgctacaggtttgttttactat |
7741488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 118 - 199
Target Start/End: Complemental strand, 7741313 - 7741232
Alignment:
| Q |
118 |
cgagagaatgaggagcagatgatgaaatataaaaggtaggggcaaagttgtgattgtattatcaatgatgtccatctcattg |
199 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||| |
|
|
| T |
7741313 |
cgagagaatgagaagcagatgatgaaatataaaaggtaggggcaaagttgtgattgtattatcaatgttttccatttcattg |
7741232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 63; Significance: 1e-27; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 36657445 - 36657364
Alignment:
| Q |
19 |
tcttttaattaatatccaatcgatcgataaagtattatttgcaaatctcttccaacttgtttgctacaggtttgttttactat |
101 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36657445 |
tcttttaattaatatc-aatcaaccgataaagtattatttgcaaatctcttccatcttgtttgctacaggtttgttttactat |
36657364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 127 - 183
Target Start/End: Original strand, 36657533 - 36657589
Alignment:
| Q |
127 |
gaggagcagatgatgaaatataaaaggtaggggcaaagttgtgattgtattatcaat |
183 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||| |||||||||||||| |||| |
|
|
| T |
36657533 |
gaggagcaaatgatgaaatagaaaaggtaggggcaaaattgtgattgtattaacaat |
36657589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University