View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_439 (Length: 201)
Name: NF8912A_low_439
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_439 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 26 - 186
Target Start/End: Original strand, 45342980 - 45343140
Alignment:
| Q |
26 |
aagggccttccacttgttaaagcttcaaataaaagttgtactgaatgttttgtcggcaagcaacatagagatgccattccaaagaagagtcaatggagag |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342980 |
aagggccttccacttgttaaagcttcaaataaaagttgtactgaatgttttgtcagcaagcaacatagagatgccattccaaagaagagtcaatggagag |
45343079 |
T |
 |
| Q |
126 |
cttcccaaaaattgcagcttgtacatgctgatgtttgcgggcctattactcccaactccaa |
186 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45343080 |
cttcccataaattgcagcttgtacatgctgatatttgcgggcctattactcccaactccaa |
45343140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University