View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_441 (Length: 201)
Name: NF8912A_low_441
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_441 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 73 - 177
Target Start/End: Complemental strand, 38558120 - 38558013
Alignment:
| Q |
73 |
ttagaatgagaaacatgatataagttcnnnnnnnnnnnnngaatgacaacaacaatataacattttcatagacaaatatat---atgagtctaattggaa |
169 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
38558120 |
ttagaatgagaaacatgatataagttctttttctttttttgaatgacaataacaatataacattttcatagacaaatatatatgatgagtataattggaa |
38558021 |
T |
|
| Q |
170 |
gtgaaaaa |
177 |
Q |
| |
|
|||||||| |
|
|
| T |
38558020 |
gtgaaaaa |
38558013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University