View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8912A_low_45 (Length: 392)
Name: NF8912A_low_45
Description: NF8912A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8912A_low_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 11 - 378
Target Start/End: Original strand, 47116765 - 47117128
Alignment:
| Q |
11 |
agatggacatcactccaagcttcctcatacccttgttatttcatttccttatgatatctcnnnnnnnctgacattgttttgtttcatcgcttctcaggta |
110 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47116765 |
agatggacaccactccaagcttcctcatacccttgttatttcatttccttatgatatctctttttttctgacattgttttgtttcatcgcttctcaggta |
47116864 |
T |
 |
| Q |
111 |
attacaatagttatattttatcaaagatattcaataaccaatttcttttatatctttagtttcaattcaaggagataaatattcataccttttaacgatc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116865 |
attacaatagttatattttatcaaagatattcaataaccaatttcttttatatctttagtttcaattcaaggagataaatattcataccttttaacgatc |
47116964 |
T |
 |
| Q |
211 |
aaatcacaaagcaaggtaagcaatatcaacgtatcaatgactcgatcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcgg |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116965 |
aaatcacaaagcaaggtaagcaatatcaacgtatcaatgac----tcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcgg |
47117060 |
T |
 |
| Q |
311 |
agaatgtatgataggcaacaaagctcaacgggaacgccaacatcaccatcttcgccggtgatgatgtc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
47117061 |
agaatgtatgataggcaacaaagctcaacgggaacgccaacatcaccgtcttcaccggtgatgatgtc |
47117128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University